ID: 1162165834

View in Genome Browser
Species Human (GRCh38)
Location 19:8752244-8752266
Sequence TGTGGGTGTGTGTTGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162165834_1162165837 -8 Left 1162165834 19:8752244-8752266 CCTCTCTCCAACACACACCCACA No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165834_1162165842 4 Left 1162165834 19:8752244-8752266 CCTCTCTCCAACACACACCCACA No data
Right 1162165842 19:8752271-8752293 CCACAGGCAGGTCACCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162165834 Original CRISPR TGTGGGTGTGTGTTGGAGAG AGG (reversed) Intergenic