ID: 1162165835

View in Genome Browser
Species Human (GRCh38)
Location 19:8752251-8752273
Sequence TGGGATGTGTGGGTGTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162165835_1162165842 -3 Left 1162165835 19:8752251-8752273 CCAACACACACCCACACATCCCA No data
Right 1162165842 19:8752271-8752293 CCACAGGCAGGTCACCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162165835 Original CRISPR TGGGATGTGTGGGTGTGTGT TGG (reversed) Intergenic