ID: 1162165836

View in Genome Browser
Species Human (GRCh38)
Location 19:8752255-8752277
Sequence CACACACCCACACATCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162165831_1162165836 -6 Left 1162165831 19:8752238-8752260 CCTTCCCCTCTCTCCAACACACA No data
Right 1162165836 19:8752255-8752277 CACACACCCACACATCCCACAGG No data
1162165832_1162165836 -10 Left 1162165832 19:8752242-8752264 CCCCTCTCTCCAACACACACCCA No data
Right 1162165836 19:8752255-8752277 CACACACCCACACATCCCACAGG No data
1162165827_1162165836 26 Left 1162165827 19:8752206-8752228 CCAATCTCATGGCAGGTTCATGC No data
Right 1162165836 19:8752255-8752277 CACACACCCACACATCCCACAGG No data
1162165828_1162165836 2 Left 1162165828 19:8752230-8752252 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162165836 19:8752255-8752277 CACACACCCACACATCCCACAGG No data
1162165830_1162165836 -5 Left 1162165830 19:8752237-8752259 CCCTTCCCCTCTCTCCAACACAC No data
Right 1162165836 19:8752255-8752277 CACACACCCACACATCCCACAGG No data
1162165829_1162165836 1 Left 1162165829 19:8752231-8752253 CCTTTTCCCTTCCCCTCTCTCCA No data
Right 1162165836 19:8752255-8752277 CACACACCCACACATCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162165836 Original CRISPR CACACACCCACACATCCCAC AGG Intergenic