ID: 1162165837

View in Genome Browser
Species Human (GRCh38)
Location 19:8752259-8752281
Sequence CACCCACACATCCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162165833_1162165837 -7 Left 1162165833 19:8752243-8752265 CCCTCTCTCCAACACACACCCAC No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165829_1162165837 5 Left 1162165829 19:8752231-8752253 CCTTTTCCCTTCCCCTCTCTCCA No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165832_1162165837 -6 Left 1162165832 19:8752242-8752264 CCCCTCTCTCCAACACACACCCA No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165831_1162165837 -2 Left 1162165831 19:8752238-8752260 CCTTCCCCTCTCTCCAACACACA No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165827_1162165837 30 Left 1162165827 19:8752206-8752228 CCAATCTCATGGCAGGTTCATGC No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165830_1162165837 -1 Left 1162165830 19:8752237-8752259 CCCTTCCCCTCTCTCCAACACAC No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165828_1162165837 6 Left 1162165828 19:8752230-8752252 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data
1162165834_1162165837 -8 Left 1162165834 19:8752244-8752266 CCTCTCTCCAACACACACCCACA No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162165837 Original CRISPR CACCCACACATCCCACAGGC AGG Intergenic
No off target data available for this crispr