ID: 1162166903

View in Genome Browser
Species Human (GRCh38)
Location 19:8759715-8759737
Sequence CACCCACACATCCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162166894_1162166903 6 Left 1162166894 19:8759686-8759708 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data
1162166900_1162166903 -8 Left 1162166900 19:8759700-8759722 CCTCTCTCCAACACACACCCACA No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data
1162166896_1162166903 -1 Left 1162166896 19:8759693-8759715 CCCTTCCCCTCTCTCCAACACAC No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data
1162166898_1162166903 -6 Left 1162166898 19:8759698-8759720 CCCCTCTCTCCAACACACACCCA No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data
1162166899_1162166903 -7 Left 1162166899 19:8759699-8759721 CCCTCTCTCCAACACACACCCAC No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data
1162166895_1162166903 5 Left 1162166895 19:8759687-8759709 CCTTTTCCCTTCCCCTCTCTCCA No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data
1162166893_1162166903 30 Left 1162166893 19:8759662-8759684 CCAATCTCATGGCAGGTTCATGC No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data
1162166897_1162166903 -2 Left 1162166897 19:8759694-8759716 CCTTCCCCTCTCTCCAACACACA No data
Right 1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162166903 Original CRISPR CACCCACACATCCCACAGGC AGG Intergenic
No off target data available for this crispr