ID: 1162168898

View in Genome Browser
Species Human (GRCh38)
Location 19:8773416-8773438
Sequence GCATGAACCTGCCATGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162168898_1162168907 26 Left 1162168898 19:8773416-8773438 CCAATCTCATGGCAGGTTCATGC No data
Right 1162168907 19:8773465-8773487 CACACACCCACACATCCCACAGG No data
1162168898_1162168908 30 Left 1162168898 19:8773416-8773438 CCAATCTCATGGCAGGTTCATGC No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162168898 Original CRISPR GCATGAACCTGCCATGAGAT TGG (reversed) Intergenic
No off target data available for this crispr