ID: 1162168902

View in Genome Browser
Species Human (GRCh38)
Location 19:8773448-8773470
Sequence TGTGTGTTGGAGAGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162168902_1162168913 10 Left 1162168902 19:8773448-8773470 CCTTCCCCTCTCTCCAACACACA No data
Right 1162168913 19:8773481-8773503 CCACAGGCAGGTCACCCCGCAGG No data
1162168902_1162168908 -2 Left 1162168902 19:8773448-8773470 CCTTCCCCTCTCTCCAACACACA No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168902_1162168907 -6 Left 1162168902 19:8773448-8773470 CCTTCCCCTCTCTCCAACACACA No data
Right 1162168907 19:8773465-8773487 CACACACCCACACATCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162168902 Original CRISPR TGTGTGTTGGAGAGAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr