ID: 1162168904

View in Genome Browser
Species Human (GRCh38)
Location 19:8773453-8773475
Sequence GTGGGTGTGTGTTGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162168904_1162168913 5 Left 1162168904 19:8773453-8773475 CCCTCTCTCCAACACACACCCAC No data
Right 1162168913 19:8773481-8773503 CCACAGGCAGGTCACCCCGCAGG No data
1162168904_1162168908 -7 Left 1162168904 19:8773453-8773475 CCCTCTCTCCAACACACACCCAC No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162168904 Original CRISPR GTGGGTGTGTGTTGGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr