ID: 1162168904 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:8773453-8773475 |
| Sequence | GTGGGTGTGTGTTGGAGAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1162168904_1162168913 | 5 | Left | 1162168904 | 19:8773453-8773475 | CCCTCTCTCCAACACACACCCAC | No data | ||
| Right | 1162168913 | 19:8773481-8773503 | CCACAGGCAGGTCACCCCGCAGG | No data | ||||
| 1162168904_1162168908 | -7 | Left | 1162168904 | 19:8773453-8773475 | CCCTCTCTCCAACACACACCCAC | No data | ||
| Right | 1162168908 | 19:8773469-8773491 | CACCCACACATCCCACAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1162168904 | Original CRISPR | GTGGGTGTGTGTTGGAGAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||