ID: 1162168905

View in Genome Browser
Species Human (GRCh38)
Location 19:8773454-8773476
Sequence TGTGGGTGTGTGTTGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162168905_1162168908 -8 Left 1162168905 19:8773454-8773476 CCTCTCTCCAACACACACCCACA No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168905_1162168913 4 Left 1162168905 19:8773454-8773476 CCTCTCTCCAACACACACCCACA No data
Right 1162168913 19:8773481-8773503 CCACAGGCAGGTCACCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162168905 Original CRISPR TGTGGGTGTGTGTTGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr