ID: 1162168908

View in Genome Browser
Species Human (GRCh38)
Location 19:8773469-8773491
Sequence CACCCACACATCCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162168901_1162168908 -1 Left 1162168901 19:8773447-8773469 CCCTTCCCCTCTCTCCAACACAC No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168900_1162168908 5 Left 1162168900 19:8773441-8773463 CCTTTTCCCTTCCCCTCTCTCCA No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168903_1162168908 -6 Left 1162168903 19:8773452-8773474 CCCCTCTCTCCAACACACACCCA No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168898_1162168908 30 Left 1162168898 19:8773416-8773438 CCAATCTCATGGCAGGTTCATGC No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168902_1162168908 -2 Left 1162168902 19:8773448-8773470 CCTTCCCCTCTCTCCAACACACA No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168905_1162168908 -8 Left 1162168905 19:8773454-8773476 CCTCTCTCCAACACACACCCACA No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168899_1162168908 6 Left 1162168899 19:8773440-8773462 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data
1162168904_1162168908 -7 Left 1162168904 19:8773453-8773475 CCCTCTCTCCAACACACACCCAC No data
Right 1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162168908 Original CRISPR CACCCACACATCCCACAGGC AGG Intergenic
No off target data available for this crispr