ID: 1162170654

View in Genome Browser
Species Human (GRCh38)
Location 19:8786237-8786259
Sequence CACCCACACATCCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162170647_1162170654 -1 Left 1162170647 19:8786215-8786237 CCCTTCCCCTCTCTCCAACACAC No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data
1162170650_1162170654 -7 Left 1162170650 19:8786221-8786243 CCCTCTCTCCAACACACACCCAC No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data
1162170644_1162170654 30 Left 1162170644 19:8786184-8786206 CCAATCTCATGGCAGGTTCATGC No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data
1162170645_1162170654 6 Left 1162170645 19:8786208-8786230 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data
1162170648_1162170654 -2 Left 1162170648 19:8786216-8786238 CCTTCCCCTCTCTCCAACACACA No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data
1162170649_1162170654 -6 Left 1162170649 19:8786220-8786242 CCCCTCTCTCCAACACACACCCA No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data
1162170646_1162170654 5 Left 1162170646 19:8786209-8786231 CCTTTTCCCTTCCCCTCTCTCCA No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data
1162170651_1162170654 -8 Left 1162170651 19:8786222-8786244 CCTCTCTCCAACACACACCCACA No data
Right 1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162170654 Original CRISPR CACCCACACATCCCACAGGC AGG Intergenic
No off target data available for this crispr