ID: 1162174753

View in Genome Browser
Species Human (GRCh38)
Location 19:8822800-8822822
Sequence TTGAAGAAGGATGGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1518
Summary {0: 1, 1: 0, 2: 10, 3: 133, 4: 1374}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162174753_1162174763 23 Left 1162174753 19:8822800-8822822 CCATCCTTCCCATCCTTCTTCAA 0: 1
1: 0
2: 10
3: 133
4: 1374
Right 1162174763 19:8822846-8822868 GGGCCTTTATTTTGCTGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 159
1162174753_1162174759 2 Left 1162174753 19:8822800-8822822 CCATCCTTCCCATCCTTCTTCAA 0: 1
1: 0
2: 10
3: 133
4: 1374
Right 1162174759 19:8822825-8822847 GCAAGTTCCGGCTTCCACACTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1162174753_1162174760 3 Left 1162174753 19:8822800-8822822 CCATCCTTCCCATCCTTCTTCAA 0: 1
1: 0
2: 10
3: 133
4: 1374
Right 1162174760 19:8822826-8822848 CAAGTTCCGGCTTCCACACTGGG 0: 1
1: 0
2: 0
3: 12
4: 135
1162174753_1162174758 -10 Left 1162174753 19:8822800-8822822 CCATCCTTCCCATCCTTCTTCAA 0: 1
1: 0
2: 10
3: 133
4: 1374
Right 1162174758 19:8822813-8822835 CCTTCTTCAAATGCAAGTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162174753 Original CRISPR TTGAAGAAGGATGGGAAGGA TGG (reversed) Intronic
900073716 1:794679-794701 TGGAAGGAGAATTGGAAGGAAGG - Intergenic
900471890 1:2859183-2859205 TGGAGGAAGGAAGGGAGGGAGGG + Intergenic
900482183 1:2904752-2904774 ACGAGGAAGGATGGGAGGGAGGG - Intergenic
900681670 1:3920116-3920138 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
900707294 1:4088781-4088803 TTGAAGGACGGTGGGAAGCAGGG + Intergenic
900748827 1:4380562-4380584 TCTAAGAAGGTTGGGGAGGAGGG + Intergenic
900932130 1:5744113-5744135 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
900932137 1:5744133-5744155 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
900932160 1:5744189-5744211 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
900932169 1:5744213-5744235 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
900932194 1:5744273-5744295 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
901061808 1:6475207-6475229 GGGAAGGAGGGTGGGAAGGAGGG - Intronic
901061824 1:6475244-6475266 GGGAAGGAGGGTGGGAAGGAGGG - Intronic
901264915 1:7903032-7903054 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264924 1:7903059-7903081 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264933 1:7903086-7903108 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264942 1:7903113-7903135 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264956 1:7903158-7903180 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264970 1:7903203-7903225 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264979 1:7903230-7903252 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264993 1:7903275-7903297 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901265002 1:7903302-7903324 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901497805 1:9631979-9632001 TAGAAGAAGGAAGGAAGGGAGGG - Intergenic
901595608 1:10383074-10383096 TGAAAGAGGGATGGGAACGAGGG + Intergenic
901667522 1:10835154-10835176 TAAAAGAAGGAGGGGAAAGAGGG + Intergenic
901827019 1:11868814-11868836 TTGAACAGGGGAGGGAAGGATGG - Intergenic
902088739 1:13884926-13884948 AAGAAGAAGGAAGGGAGGGAGGG - Intergenic
902116524 1:14125893-14125915 TTGAGGAACCATGGGAAGGCAGG + Intergenic
902260694 1:15222738-15222760 GGGAAGAAGGAAAGGAAGGAAGG + Intergenic
902755672 1:18547803-18547825 GTGTAAATGGATGGGAAGGAGGG + Intergenic
902758991 1:18568601-18568623 AAGAAGAAGGGAGGGAAGGAGGG + Intergenic
902795008 1:18795430-18795452 TTAGGGAAGGATGAGAAGGAGGG - Intergenic
902926417 1:19698703-19698725 AGGAAGAAGAAAGGGAAGGAGGG - Intronic
903038877 1:20513416-20513438 GGAAAGAAGGAAGGGAAGGAAGG + Intergenic
903588135 1:24432616-24432638 CTGAAGAAGGATGGGAACCCAGG - Intronic
904019392 1:27450833-27450855 ATGAAGAAGGGAGGGAAGGGAGG - Intronic
904382904 1:30123550-30123572 TGGAAGAAAGAAGGGAAGGAAGG + Intergenic
904466065 1:30708139-30708161 GGGAAGGAGGTTGGGAAGGAGGG + Intergenic
904695224 1:32326784-32326806 CTGAAGTAGGGTGGGAGGGAGGG + Intronic
904940805 1:34164215-34164237 GTGTTGAGGGATGGGAAGGAGGG - Intronic
905191196 1:36236443-36236465 GGGAAGAAGGAAGGGAAGAAAGG - Intronic
905506872 1:38486667-38486689 GGGAAGAAGGAAGGGAGGGAGGG + Intergenic
905537254 1:38732188-38732210 TAGAATAGGGATGGGAAGGTGGG - Intergenic
905921542 1:41722552-41722574 AGGCAGAAGGAAGGGAAGGAGGG - Intronic
905968264 1:42117459-42117481 TTGCATGATGATGGGAAGGATGG + Intergenic
906228024 1:44138152-44138174 GTGAAGGAGGAGGGGAATGAGGG + Intergenic
906439472 1:45828579-45828601 GTGAAGAATGGTGGGAAGAAGGG + Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906893076 1:49739153-49739175 TTGAAAAACGATGAGAAGAATGG + Intronic
906925383 1:50110364-50110386 ATGGGGAAGGATGGGAATGAGGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907264697 1:53250476-53250498 AAGAAGGAGGAAGGGAAGGAGGG + Intronic
907538370 1:55186829-55186851 CTGAAGATGGATGGGACTGATGG + Intronic
908740006 1:67317740-67317762 TGAAAGAAAGATGCGAAGGAGGG - Intronic
908742293 1:67341409-67341431 ACAAAGAAGGAAGGGAAGGAAGG + Intronic
908818899 1:68062288-68062310 TTGAATAAGAATGGTAAGAAAGG - Intergenic
908903668 1:68984235-68984257 GGGAAGAAGGATGGGAAGGAAGG - Intergenic
909101468 1:71354566-71354588 AAGAAGAAGGAAGGGAGGGAGGG - Intergenic
909177229 1:72376693-72376715 TATAAGAAAGAAGGGAAGGAAGG - Intergenic
909346275 1:74591260-74591282 TAGCAGAAGCAAGGGAAGGAAGG + Intronic
909349811 1:74638027-74638049 AGGAAGGAGGATGAGAAGGATGG + Intronic
909397624 1:75188027-75188049 ATGTAGAAGGAAGGGAAGGAAGG - Intergenic
909454757 1:75837790-75837812 TTGATGACTGATTGGAAGGAAGG - Intronic
909583828 1:77266903-77266925 ATGAAGAAGGCAGAGAAGGATGG + Intergenic
909685386 1:78342241-78342263 TGGGAGTAGGATGGGGAGGAGGG + Intronic
909903137 1:81162457-81162479 TAAAAGAAAGATAGGAAGGAAGG + Intergenic
910162144 1:84284808-84284830 AAGAAGAAGGAGGGGAAGGAGGG + Intergenic
910476595 1:87614455-87614477 TTGAAGAAGAAAGGAAGGGAGGG + Intergenic
910905533 1:92173609-92173631 GTTAAGAACAATGGGAAGGAAGG + Intronic
912038526 1:105353896-105353918 TTGAAGTAGAAATGGAAGGAGGG + Intergenic
912169507 1:107081498-107081520 ATGAAGAAGAATGGAAAGGAAGG + Intergenic
912319521 1:108698763-108698785 ATCAAGAAAGATGGGAAGGAAGG + Exonic
912548709 1:110470137-110470159 GGGAAGAAGGAAGGGAAGGGAGG - Intergenic
913051869 1:115123763-115123785 CTTAAGAAGGATGGGTGGGAGGG + Intergenic
913090317 1:115472322-115472344 TTGACTAAGGATGGGAATGGAGG - Intergenic
913157594 1:116115154-116115176 TTAAAGAATGATGGGTAGGCAGG + Intronic
913195681 1:116454400-116454422 AAGAAGAAGAAAGGGAAGGAGGG + Intergenic
913270089 1:117084666-117084688 TTGAAGAGGGATGCTCAGGAAGG + Intronic
913275987 1:117138176-117138198 CGGAAGGAGGATGGGAAGGGAGG - Intergenic
913358707 1:117954241-117954263 TTGAGGAAGTGTGGGAAGAAGGG + Intronic
913397951 1:118393409-118393431 GTGAAGAGGAATAGGAAGGAGGG - Intergenic
913531793 1:119738799-119738821 TTGCAGAGAGATGGGGAGGAGGG + Intronic
913532066 1:119740533-119740555 TTGCAGAGGGAGGGGGAGGAGGG + Intronic
913672802 1:121113806-121113828 TTGAAAAAGGATGAGAAGAGAGG - Intergenic
914024578 1:143901180-143901202 TTGAAAAAGGATGAGAAGAGAGG - Intergenic
914260703 1:145996818-145996840 GAGAGGAAGGAGGGGAAGGAGGG + Intergenic
914663063 1:149809201-149809223 TTGAAAAAGGATGAGAAGAGAGG - Intronic
914666231 1:149835193-149835215 AAGAGGAAGGAAGGGAAGGAAGG - Intergenic
914669536 1:149858605-149858627 AAGAGGAAGGAAGGGAAGGAAGG + Intronic
914887700 1:151599023-151599045 TCAAAGAAGGATGGGAGTGAGGG - Intergenic
915182469 1:154074379-154074401 TTGAGGAAGGAAGAGAAGGAGGG - Intronic
915246863 1:154561809-154561831 TAGAAGGAGGTTGGGAAGAAAGG + Intergenic
915607281 1:156960583-156960605 TTGGAGAGTGATGAGAAGGATGG - Intronic
915901249 1:159848142-159848164 TTTCAGCAGGATGGGCAGGATGG - Intronic
916121697 1:161533978-161534000 TTCAACAGGGATGGGAAGAAAGG + Intergenic
916187837 1:162150111-162150133 TTGCAGCAGGGAGGGAAGGATGG - Intronic
916259714 1:162829408-162829430 AGGAAGAAGGAAAGGAAGGAAGG - Intronic
916261379 1:162845960-162845982 CTGAAGAAGGAAGGTAAGGTGGG - Intronic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916326429 1:163565017-163565039 TGGGAGAATGAGGGGAAGGAAGG + Intergenic
916558080 1:165910168-165910190 TGGAACAAGGAAGGGATGGAAGG + Intronic
916610671 1:166388382-166388404 AGGAAGAAGGAAGGGAAGGGAGG + Intergenic
917024075 1:170622930-170622952 TTGTAGGAGGATGGAATGGAGGG - Intergenic
917125205 1:171681180-171681202 TTAAAGAAAGAAAGGAAGGAAGG - Intergenic
917369765 1:174279810-174279832 AAAAAGAAGGATGGGGAGGAAGG - Intronic
917562038 1:176168492-176168514 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
917646952 1:177038484-177038506 GGAAAGAAGGAAGGGAAGGAGGG + Intronic
917758717 1:178132017-178132039 GGGAAGAAGGAGGGGAAGGGAGG - Intronic
917904689 1:179576729-179576751 TTGAAGAATCATAGGCAGGAAGG + Intergenic
918194902 1:182212122-182212144 TTGTGGAAGGTGGGGAAGGAAGG + Intergenic
918373698 1:183887190-183887212 GAGAAGAAGGAGGGGAAGGAGGG - Intronic
918813100 1:189146590-189146612 AGAAAGGAGGATGGGAAGGAAGG + Intergenic
919058828 1:192605740-192605762 TGGAAGGAGGAAGGGAGGGAGGG + Intergenic
919145882 1:193634362-193634384 GAGAAGAAGGAAGGGAGGGAAGG - Intergenic
919392977 1:197010586-197010608 GGAAAGAAGGATGGGAGGGAAGG + Intergenic
919505915 1:198397487-198397509 TGGAAGGAGGAAAGGAAGGAGGG - Intergenic
919613136 1:199771972-199771994 AGGAAGAAGGAAGGGAAGAAGGG + Intergenic
919675257 1:200375899-200375921 TTGAAGCAGGAGGGAAAGCAGGG - Intergenic
919720755 1:200832263-200832285 TTGTTGAAGGATGGGACAGATGG + Exonic
919938521 1:202270880-202270902 CTGAAGCAGGGAGGGAAGGAAGG - Intronic
920211706 1:204333180-204333202 GTGAGGAAGAAGGGGAAGGAAGG + Intronic
920646752 1:207809351-207809373 TTGAAGACAGATGGGAAAGATGG + Intergenic
920873860 1:209816389-209816411 AGGAGGAAGGATGGGAGGGAAGG + Intergenic
920987051 1:210900825-210900847 GAGAAGGAGGATGGGAAGAATGG - Intronic
921206537 1:212854357-212854379 TTCCAGAAGGAAGGGAAGGAGGG - Intergenic
921442391 1:215203002-215203024 AGGAAGAGGGAAGGGAAGGAGGG - Intronic
921639865 1:217540208-217540230 TTAAGGAAGGAAGGAAAGGAAGG + Intronic
922140299 1:222877848-222877870 GTGAAGAAGGGAGGGCAGGATGG + Intronic
922269575 1:224019586-224019608 TGGAAGGAGAATTGGAAGGAAGG - Intergenic
922339227 1:224642105-224642127 TTGTTCAAGGATGTGAAGGATGG + Intronic
922388772 1:225116044-225116066 TTAGAGAAGGATGGGTAGGTGGG + Intronic
923150604 1:231229906-231229928 CTGAAGATGGATGGTAATGAGGG + Intronic
923791479 1:237115042-237115064 TGCAAGGAGGAGGGGAAGGAAGG + Intronic
923850827 1:237792524-237792546 TGGAGGAAGGATGGGACAGAGGG + Intronic
923888891 1:238188955-238188977 TTCAAGAAGTATGGTTAGGATGG - Intergenic
924202587 1:241675127-241675149 AGGAAGAAGGGAGGGAAGGAGGG - Intronic
924683778 1:246266274-246266296 TTAAAAAAAGATGGGATGGATGG - Intronic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
1063100874 10:2949300-2949322 TTAAAGAAAGAAAGGAAGGAAGG + Intergenic
1063484261 10:6404528-6404550 GTAAGGAAGGAAGGGAAGGAAGG - Intergenic
1063569566 10:7202403-7202425 TTTATGGAGGATGGGAAGCATGG - Intronic
1063611319 10:7564026-7564048 TTGAAGAAAGCTGGGTAGAATGG + Intronic
1063640488 10:7825415-7825437 CTGGAGAAGGATGGGGATGATGG - Intronic
1063697990 10:8356392-8356414 AGGAAGAAGGCAGGGAAGGAAGG - Intergenic
1063774684 10:9248747-9248769 TGAAAGGAAGATGGGAAGGAAGG + Intergenic
1063919088 10:10913881-10913903 AGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1064462767 10:15551029-15551051 TTGGAGAAGAATGGGGTGGATGG + Intronic
1064540870 10:16403745-16403767 TTGCAGAAAGGTGGGTAGGAGGG + Intergenic
1064635240 10:17358589-17358611 AGGAAGAAGGAGGAGAAGGAGGG + Intronic
1064642099 10:17425702-17425724 AGGAGGAAGGAAGGGAAGGAAGG + Intronic
1064642106 10:17425726-17425748 AGGAGGAAGGAAGGGAAGGAAGG + Intronic
1064800644 10:19066910-19066932 ACGAAGAAGGAAGGGAGGGAAGG - Intronic
1065022609 10:21512784-21512806 TTCAAGAAGGAAAGGAAGGAAGG + Intergenic
1065047045 10:21754185-21754207 TTGAAGTAGGATGGGGTGGGGGG - Intergenic
1065186874 10:23176829-23176851 GTAAAGAGGGATGGTAAGGATGG - Intergenic
1065198106 10:23286489-23286511 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
1065327609 10:24563064-24563086 ATGGAGAAGGGTGGGGAGGAGGG - Intergenic
1065383936 10:25115392-25115414 GGGAGGAAGGAAGGGAAGGAGGG - Intergenic
1065639839 10:27770463-27770485 AAGAAGAAGGGAGGGAAGGAGGG - Intergenic
1065709037 10:28497730-28497752 AGGAAGGAGGAAGGGAAGGAAGG + Intergenic
1065905463 10:30247318-30247340 TTGAAGGAGGAGGGGAAGTTGGG - Intergenic
1065983648 10:30928887-30928909 TTGAAGGAGGAAGGGAGGCATGG - Intronic
1065996030 10:31060225-31060247 TTTAAGAAGGAAGGAAGGGAAGG + Intergenic
1066064413 10:31751710-31751732 CTCAGGAAGGGTGGGAAGGAAGG - Intergenic
1066209908 10:33226436-33226458 TTTAAGAAGGAATGGAAGGGAGG - Intronic
1066423167 10:35280388-35280410 AGGAAGAAGGAAAGGAAGGAAGG + Intronic
1067411405 10:46068040-46068062 TAGAAAAAGGATATGAAGGAGGG + Intergenic
1067538800 10:47136774-47136796 AAAAAGAAGGAAGGGAAGGAAGG - Intergenic
1067905334 10:50284956-50284978 GTGAGGAAAGTTGGGAAGGAGGG - Intergenic
1067925524 10:50504573-50504595 AGGAAGAAGGATGGGAAGATGGG + Intronic
1067940320 10:50649828-50649850 TTTAAGAAAGATGGCAAGAAGGG + Intergenic
1068232744 10:54191961-54191983 AAGGAGAAGGAGGGGAAGGAAGG + Intronic
1068261747 10:54592307-54592329 AGGAGGAAGGAAGGGAAGGAGGG - Intronic
1068329476 10:55543873-55543895 TTGAAGAAAAAAAGGAAGGAAGG - Intronic
1068728668 10:60331653-60331675 TGAAAGAAGGATGGGCAGGAAGG - Intronic
1068800967 10:61139341-61139363 AGGAAGAAGGAAAGGAAGGAAGG - Intergenic
1068938703 10:62660070-62660092 TTGAATAAAGATGTGAAGGTTGG + Intronic
1069190598 10:65483206-65483228 TTGTAGAAAGAAGTGAAGGAAGG - Intergenic
1069338823 10:67386981-67387003 TTAAAGAAGGATAGGAAGGTAGG - Intronic
1069367535 10:67710099-67710121 ATGAAAAAGGATAGGAAGAAAGG + Intergenic
1069533124 10:69233538-69233560 TAGAAGAAACATGGGAAGGCTGG + Intronic
1069771098 10:70901103-70901125 TTGAGGAAGGAAAGGAAGGAGGG - Intergenic
1070275686 10:75004460-75004482 TTGCTGAAGGATGGGATGAAGGG - Intronic
1070578431 10:77698489-77698511 ATGATGAAGGAGGAGAAGGAGGG + Intergenic
1071083400 10:81839577-81839599 AGAAAGAAGGAAGGGAAGGAGGG + Intergenic
1071431659 10:85611617-85611639 ACCAAGAAGGATGAGAAGGATGG - Intronic
1071468453 10:85961724-85961746 TAGAAGGAGGATGGGAAGGAAGG - Intronic
1071771719 10:88736138-88736160 GGGAAAAAGGAAGGGAAGGAGGG + Intronic
1071794303 10:88989273-88989295 GGGAAGAAGGAATGGAAGGAGGG - Intronic
1071822317 10:89291135-89291157 ATGAAGGAGGAAAGGAAGGAAGG - Intronic
1071837356 10:89431778-89431800 TTGAAGAGGGAAGGCATGGAGGG - Exonic
1071954338 10:90741592-90741614 TGGAAGAAGTGTGGGAATGATGG - Exonic
1072423775 10:95311662-95311684 ATGATTAAGGATGGAAAGGAGGG + Intergenic
1072723216 10:97793675-97793697 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1072754733 10:98011768-98011790 TTGTGGAAGGAAGGAAAGGAGGG + Intronic
1072778472 10:98225285-98225307 GTGAAGAGGGATGGGGAGGTAGG - Intronic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1072986292 10:100143866-100143888 TGGAAGACGGATGAGAAGCATGG - Intergenic
1073153059 10:101324745-101324767 AGGAAGAAAGAAGGGAAGGAAGG - Intergenic
1073359853 10:102889655-102889677 TGGAGGGAGGAAGGGAAGGAAGG - Intronic
1073572776 10:104594792-104594814 TTGAAGAATGATTGTAAAGAGGG + Intergenic
1073625491 10:105091556-105091578 AGGAAGGAGGAAGGGAAGGAAGG - Intronic
1073662649 10:105493870-105493892 AAGAAGAAGGAAGGGAAGGAGGG + Intergenic
1073715521 10:106102199-106102221 TTGCAGAAGGATTGGCAGGTTGG - Intergenic
1073801941 10:107051026-107051048 TTGTGGAAGGAAGGGAGGGAAGG - Intronic
1073998776 10:109346110-109346132 TGGAACAAGGAAGGGAAGGCTGG + Intergenic
1073999967 10:109361386-109361408 GTGAAAGAGGATGGGAAAGAGGG + Intergenic
1074006033 10:109424543-109424565 GGGAAGAAGAAAGGGAAGGAAGG + Intergenic
1074134919 10:110617980-110618002 CTGAAGAAGGACAGGAATGAGGG - Intergenic
1074371328 10:112902989-112903011 GTGAGGAAGGAAGGGAAGGAGGG - Intergenic
1074428448 10:113372522-113372544 TTGAAGTAGGAAAGGAATGAAGG + Intergenic
1074496273 10:113982780-113982802 TTCTGAAAGGATGGGAAGGAAGG - Intergenic
1074731825 10:116386496-116386518 AGGAAGAAGGAAGGGAGGGAAGG - Intergenic
1074827972 10:117228408-117228430 GTGAGGAAGGAAGGAAAGGAGGG - Intergenic
1074877032 10:117621699-117621721 GGGAAGCAGGAGGGGAAGGAAGG - Intergenic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075087474 10:119423142-119423164 TGGAAGAAGGAAGGGAAGGGAGG - Intronic
1075105581 10:119538140-119538162 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
1075122719 10:119675923-119675945 TCAAAGAAGGAAGGGAGGGAGGG - Intronic
1075300891 10:121323173-121323195 TGGAGGCAGGCTGGGAAGGAGGG + Intergenic
1075902083 10:126051362-126051384 AGGAAGTAGGAAGGGAAGGAGGG - Intronic
1075923718 10:126234167-126234189 AAGAAAAAAGATGGGAAGGAAGG + Intronic
1076001507 10:126916726-126916748 AGGAAGAAAGAAGGGAAGGAAGG - Intronic
1076039801 10:127236389-127236411 AGGAAGGAGGATGGGAGGGAGGG - Intronic
1076483195 10:130798264-130798286 TTAAAGAAAGTTGAGAAGGAGGG - Intergenic
1076896088 10:133312973-133312995 AGGAACAAGGATGGGGAGGATGG - Exonic
1077279655 11:1736869-1736891 TTGGAGAGGGAAGGGAAGGGAGG + Intronic
1077363648 11:2152449-2152471 TGGAGGACGGATGGGCAGGAGGG + Intronic
1077800723 11:5533366-5533388 CTGAAGCAGGATTGGATGGATGG - Intronic
1078135803 11:8650471-8650493 GGGAAGGAGGAAGGGAAGGAGGG + Intronic
1078526768 11:12107427-12107449 AAGAAGAAGGAAGGGAGGGAGGG - Intronic
1078582904 11:12552746-12552768 TTGAAGAGGGACAGGAAAGAAGG + Intergenic
1078636978 11:13060739-13060761 ATGGAGAAGGGCGGGAAGGAGGG + Intergenic
1079021710 11:16914566-16914588 TTGTAGTTGGATGTGAAGGAAGG - Intronic
1079355482 11:19726971-19726993 TTGAAGATGGGAGGGATGGATGG + Intronic
1079489169 11:20968346-20968368 TTAAAGAAAGAAAGGAAGGAAGG + Intronic
1079497731 11:21064653-21064675 TGGAGGAAGGATGGGAAAGTGGG + Intronic
1080135031 11:28844603-28844625 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1080294425 11:30709217-30709239 AGGAAGAAAGAAGGGAAGGAAGG - Intergenic
1080572282 11:33567198-33567220 TGGAAAAAGGATGGGCAAGAAGG + Intronic
1080671526 11:34383839-34383861 AGGAAGAAGGGAGGGAAGGAAGG - Intergenic
1080680891 11:34474974-34474996 AAGAAGAAGGATAGGAAGAAAGG - Intergenic
1080767188 11:35307800-35307822 TTTAAAATGGATGGGAAGGGAGG + Intronic
1080905260 11:36538850-36538872 TTGGAGATGGGTGGGAAGGGAGG - Intronic
1081095264 11:38924958-38924980 AGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1081208351 11:40301065-40301087 CTAAAGAAGCTTGGGAAGGAAGG + Intronic
1081330224 11:41792316-41792338 TGAAAGAAGGAAGGGAATGAGGG + Intergenic
1081662409 11:44896123-44896145 TTGAGGGAGGAAGGGAGGGATGG + Intronic
1081662565 11:44896925-44896947 TTGAGGGAGGAAGGGAGGGATGG + Intronic
1081666219 11:44918549-44918571 TTGGAGAAAGATGGGAGGGGAGG + Intronic
1081682871 11:45020994-45021016 TTTAGGGAGGATGGGAGGGATGG + Intergenic
1081692887 11:45089943-45089965 TAGAAGAAGGAAGGAAGGGAGGG + Intergenic
1081718607 11:45269063-45269085 TAGGAGAAGGAAGGGAAGAAGGG + Intronic
1081833933 11:46137932-46137954 GAGAAGAAGGAAGGGAGGGAGGG - Intergenic
1081966866 11:47175563-47175585 TGGATGAAGGATGGGGAGGCTGG - Intronic
1082620960 11:55422029-55422051 ATGAAGGAAGAAGGGAAGGAAGG - Intergenic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1082859510 11:57841031-57841053 TTAAAGAAGGAAGGAAAGGAAGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083549057 11:63572151-63572173 GAGAGGAAGGAAGGGAAGGAAGG + Intergenic
1083695847 11:64441860-64441882 GAGAAGAAGGAAGGGAGGGAGGG - Intergenic
1083696177 11:64444325-64444347 GTGAGGAAGGAAGGGAGGGAGGG - Intergenic
1084214423 11:67639827-67639849 TTGAAGAGGGAGGACAAGGAGGG - Intergenic
1085021792 11:73214654-73214676 TTGCAGCCTGATGGGAAGGAAGG - Intergenic
1085224788 11:74909894-74909916 TAGAAGATGCATGGGAAGGGTGG + Intronic
1085721113 11:78913209-78913231 GAGAAGCAGGAAGGGAAGGAAGG - Intronic
1086539350 11:87889224-87889246 GTGGAGAAGGGTGGGAAGTAAGG - Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086868955 11:92014416-92014438 TTGAAAAAAGATGGGATGAATGG - Intergenic
1087161117 11:94949066-94949088 GAGAAGAAGGAAGGAAAGGAAGG + Intergenic
1087455699 11:98383572-98383594 TGAAAGAAGGAAGGGAATGAGGG + Intergenic
1087518707 11:99201390-99201412 AGGAAGAAAGAAGGGAAGGAAGG - Intronic
1087527168 11:99330212-99330234 AGGGAGAAGGAAGGGAAGGAAGG + Intronic
1087669583 11:101089703-101089725 AAGAAGAAGGAAGGGAGGGAGGG + Intronic
1088050659 11:105510417-105510439 GGACAGAAGGATGGGAAGGATGG + Intergenic
1088250375 11:107856970-107856992 TCCAAGAAGGAAGGGAGGGAGGG + Intronic
1088375753 11:109140253-109140275 GGGAAGAAGGGAGGGAAGGAAGG - Intergenic
1088524308 11:110736322-110736344 GAAAAGAAGGAAGGGAAGGAAGG + Intergenic
1088805254 11:113346534-113346556 TTAAAGAAGGATGTGAAGCTTGG - Intronic
1088813841 11:113408601-113408623 AAGAAGAAGGAAGGGAGGGAGGG - Intergenic
1088924342 11:114285135-114285157 TTTGAGAAGGATGCCAAGGAGGG - Intronic
1089429114 11:118406525-118406547 TTGAAGAAAGAGGTGAAGAAAGG - Intronic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1089895918 11:121929879-121929901 CTTAAGAAGGAGGGGAAGGCGGG + Intergenic
1089940209 11:122408621-122408643 ATGAATAAAGATGTGAAGGAGGG - Intergenic
1089958735 11:122597178-122597200 TAAAGGAAGGAAGGGAAGGAGGG + Intergenic
1090331116 11:125932751-125932773 CTGGGGAAGGATGGAAAGGAGGG + Intergenic
1090488018 11:127132204-127132226 GGGAAGAAGGGAGGGAAGGAAGG - Intergenic
1090907993 11:131094286-131094308 GGAAAGAAGGAAGGGAAGGAAGG - Intergenic
1091039719 11:132265646-132265668 GTGAAGGTGGATGGGAAGTAGGG + Intronic
1091148038 11:133297957-133297979 TTGGAGAAAGAAGGGGAGGAGGG - Intronic
1091282566 11:134390350-134390372 CTGATGAAGGATGGGGAGGCTGG + Exonic
1091297637 11:134485304-134485326 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1091335153 11:134761045-134761067 TTCAAGAAGGAAGGGAGGAAGGG - Intergenic
1091410833 12:238089-238111 TTCTAGGAGAATGGGAAGGAAGG + Intronic
1091523568 12:1273067-1273089 TTCCAGAAGGAAGGGAGGGAGGG + Intronic
1091541880 12:1469682-1469704 GTGAAGAAGGGTGAGAATGAGGG - Intronic
1091691286 12:2599193-2599215 TAGAAGAGGGAGGGGATGGAAGG - Intronic
1091936690 12:4440451-4440473 ATGGAGAAGGATGGGGTGGAAGG + Intronic
1092092272 12:5812708-5812730 AAGAAGAAGGAAGGGAGGGAGGG + Intronic
1092164846 12:6336498-6336520 TTGAGTGGGGATGGGAAGGAGGG - Intronic
1092286306 12:7130836-7130858 CTGAGAACGGATGGGAAGGAGGG - Intronic
1092711159 12:11339285-11339307 TTGAAAAAAGATGAGAAGAATGG - Intergenic
1092756293 12:11766496-11766518 ATGAAGAAGGCTGTGAAGAAAGG - Intronic
1092787129 12:12037107-12037129 TTGAATGTGGATGGGATGGATGG - Intergenic
1092892411 12:12981092-12981114 GTGTAGATGGAAGGGAAGGAAGG + Intronic
1092898733 12:13038993-13039015 TTGAAGAAGGATTTGAATGCAGG - Intergenic
1093534710 12:20209756-20209778 TGTAAGAAGGAAGGGAATGAGGG + Intergenic
1093541429 12:20291116-20291138 TTGAAGTAGGCTGGGAGGCAGGG - Intergenic
1093542909 12:20308984-20309006 TTGGAGAAGGAAGGAAGGGAGGG + Intergenic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1093838613 12:23868087-23868109 GGGAAGAAGGGAGGGAAGGAAGG - Intronic
1093914802 12:24789405-24789427 TTGTGCAATGATGGGAAGGATGG - Intergenic
1093989372 12:25572810-25572832 TGGCAGAAGGAAGGGAGGGAGGG - Intronic
1094330385 12:29285549-29285571 GGGAAGAAGGAAGGGAGGGAAGG + Intronic
1095414432 12:41960693-41960715 TTGAGAAAGGAAGGGAGGGAGGG + Intergenic
1095820105 12:46468708-46468730 TTCAAGAAGGATTGGGAGGATGG - Intergenic
1095880819 12:47134350-47134372 TTGAAGGAAGAAAGGAAGGAAGG - Intronic
1095907306 12:47391508-47391530 AGGAAGAAGGATGAGAAGCAGGG + Intergenic
1095987567 12:48009835-48009857 TTGAGGGAGGAAGGGATGGATGG - Intergenic
1096614030 12:52821666-52821688 CTGCAGTAGGATGGGAGGGAAGG - Exonic
1096766997 12:53899376-53899398 GGGAAGGAGGAAGGGAAGGAAGG + Intergenic
1096767025 12:53899477-53899499 GGGAAGCAGGAAGGGAAGGACGG + Intergenic
1096943662 12:55378966-55378988 AGGAAGGAGGGTGGGAAGGAAGG - Intergenic
1097206190 12:57323267-57323289 TTGGAGAAGGACAGGAAGGAAGG + Intronic
1097472782 12:60016538-60016560 GGGAGGAAGGAAGGGAAGGAGGG - Intergenic
1097502454 12:60422184-60422206 GTGAGGAAGGAAGGGGAGGAAGG - Intergenic
1097968220 12:65603792-65603814 TCAAAGAAGGAAGGGAGGGAGGG + Intergenic
1097983303 12:65756307-65756329 AAGAAGGAGGAAGGGAAGGAGGG - Intergenic
1097991098 12:65834638-65834660 TTGTTGAAGGAAGGGAAGGAGGG - Intronic
1098281835 12:68870051-68870073 TTGAAGAATCACAGGAAGGATGG + Intronic
1098469724 12:70829331-70829353 TTGAGGAAGAATAGTAAGGAAGG + Intronic
1099005779 12:77233243-77233265 TGGAGGGAGGAAGGGAAGGAGGG - Intergenic
1099110599 12:78555397-78555419 ATGAAGAAGGAAGGGAAGAAGGG + Intergenic
1099313315 12:81054610-81054632 TTGAAGAAGGTAGGAGAGGAAGG - Intronic
1099669273 12:85669580-85669602 TTGTGGAAGGATAGGAGGGAAGG - Intergenic
1099834255 12:87887393-87887415 TGGAAGAAGGGTTGGAAGGAGGG - Intergenic
1100140040 12:91606627-91606649 TTGAAGATGGATAGGAAGGCAGG + Intergenic
1100199201 12:92280395-92280417 AGGAAGAAAGAAGGGAAGGAAGG - Intergenic
1100550694 12:95644213-95644235 GAGAAGAAGGAGGGGAAGGAGGG - Intergenic
1100862234 12:98818211-98818233 TTAAGGAAGGAAGGGAAAGAGGG - Intronic
1100913808 12:99394729-99394751 TTGAGGAAGGATGGAATGAAAGG - Intronic
1101321925 12:103680193-103680215 TTGGAGAAGGATGGTAATGATGG + Intronic
1101348345 12:103905821-103905843 AGGAAGGAGGAAGGGAAGGAAGG + Intergenic
1101645348 12:106626446-106626468 TTGAAGAATCATGGGAAATAGGG + Intronic
1102474617 12:113180638-113180660 TTTCAGAAGGAGGGAAAGGATGG - Intronic
1102556057 12:113727330-113727352 GGGAGGAAGGATGGGAGGGAGGG - Intergenic
1102807908 12:115798296-115798318 TTGTTGAAGGAAGGAAAGGAAGG - Intergenic
1102943286 12:116962690-116962712 TTCAGGAAAGATGAGAAGGATGG - Intronic
1102992003 12:117322329-117322351 TGGAAGGAGGGAGGGAAGGAAGG - Intronic
1102992050 12:117322507-117322529 AGGAAGGAGGAGGGGAAGGAGGG - Intronic
1103172543 12:118833965-118833987 ATGGAGGAGGAAGGGAAGGAGGG + Intergenic
1103468737 12:121162875-121162897 GTGATCAAGGATAGGAAGGAAGG + Intronic
1103586661 12:121961286-121961308 GGGAAGAAGAAAGGGAAGGAAGG - Intronic
1104354703 12:128075189-128075211 ACTAAGAAGGATAGGAAGGAAGG - Intergenic
1104481235 12:129110102-129110124 GGAAAGGAGGATGGGAAGGAGGG - Intronic
1104616352 12:130273297-130273319 AGGAAGGAGGAGGGGAAGGAGGG - Intergenic
1105046757 12:133010130-133010152 TTGTAGATGGCTGGGAAGAATGG + Exonic
1105911376 13:24871184-24871206 TTTAATAAAGATGGGAAGAATGG - Intronic
1106236450 13:27865185-27865207 TTGAAGAATGAGGGGATGGAAGG + Intergenic
1106264058 13:28093905-28093927 AGGAGGAAGGGTGGGAAGGAGGG + Intronic
1106373923 13:29165240-29165262 GTGAAGAATGGAGGGAAGGATGG - Intronic
1106448935 13:29862456-29862478 GAGAAGAGGGAAGGGAAGGAGGG - Intergenic
1107017953 13:35723047-35723069 GTGAAGGAGGATGGGAAAAAAGG + Intergenic
1107097534 13:36552648-36552670 GAGAAGAAGGATGGGAAAGGGGG + Intergenic
1107221392 13:37985263-37985285 GGGAAGAAGGAAAGGAAGGAAGG + Intergenic
1107619102 13:42206675-42206697 TTGAAGATGGAGGGGAATGTGGG - Intronic
1107753304 13:43592653-43592675 ATATAGAAGGAAGGGAAGGAAGG + Intronic
1107872431 13:44759689-44759711 TGGAAGAGGGATAGGGAGGAAGG + Intergenic
1108466391 13:50720300-50720322 ATGAAGAAGGAAGGGAAGAAAGG - Intronic
1108887975 13:55212993-55213015 TTGAGTAAGGATGTGAAGGATGG + Intergenic
1109119466 13:58435985-58436007 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1109151941 13:58858048-58858070 TGAAAGAAGGAGGGGAATGAGGG - Intergenic
1109363363 13:61324826-61324848 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109734872 13:66469496-66469518 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
1110097400 13:71545529-71545551 AGGAAGAAGGGAGGGAAGGAGGG + Intronic
1110309359 13:74029896-74029918 GTGAAAAAGTATGGAAAGGAAGG + Intronic
1110313249 13:74075124-74075146 GACAAGAAGGAAGGGAAGGAAGG + Intronic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110422535 13:75329128-75329150 TTGAAGGAAGAGGGGAAGAAAGG - Intronic
1110923152 13:81114515-81114537 TTGAAGCAGGCTGGGCAGGTTGG - Intergenic
1111066254 13:83096258-83096280 AGGAAGAAGGGAGGGAAGGAAGG + Intergenic
1111090399 13:83438877-83438899 TGGAAAAAGGACTGGAAGGATGG - Intergenic
1111488599 13:88938532-88938554 AGAAAGAAGGAAGGGAAGGAGGG + Intergenic
1111516354 13:89336627-89336649 TTCAAGAAAGAGGGGAGGGAAGG + Intergenic
1111759499 13:92443803-92443825 TTGAATAAGGAAGGCAGGGAAGG + Intronic
1111957054 13:94770825-94770847 GTGAAGAAGGTGGGGAGGGAGGG + Intergenic
1112030778 13:95454448-95454470 GAGAGGAAGGAAGGGAAGGAAGG + Intronic
1112446769 13:99471621-99471643 AGGAAGAAAGAAGGGAAGGAAGG + Intergenic
1112751121 13:102584256-102584278 TTGAAAATGGATTGGATGGATGG + Intergenic
1112908978 13:104458779-104458801 ATGAAGAAGGAAGGGAGGCAAGG - Intergenic
1113581339 13:111431873-111431895 TTGAAGAAAGATGTGAAGTTAGG + Intergenic
1113665253 13:112136702-112136724 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1113680665 13:112242119-112242141 GGGAGGAAGGAAGGGAAGGAAGG + Intergenic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1114513813 14:23284922-23284944 TTGAACCTGAATGGGAAGGAGGG - Intronic
1114838258 14:26230578-26230600 TTGGAAAAGGTAGGGAAGGAAGG - Intergenic
1114861850 14:26532545-26532567 GTGAGGATGGATGGGAAGGATGG + Intronic
1115064205 14:29236625-29236647 TTGAAGAAGAAAAGGAAGGTTGG + Intergenic
1115078894 14:29426353-29426375 TTTAAGAAGGAAAAGAAGGAAGG + Intergenic
1115495203 14:33997229-33997251 TTGAAATAGGAAGGGAGGGAGGG + Intronic
1115598544 14:34933180-34933202 TTTATGAAGGATGAGAAAGAAGG + Intergenic
1115707948 14:36017401-36017423 TGGAAGCATGATGGGAAGGCAGG - Intergenic
1115911176 14:38257552-38257574 TTGATGAGGGGTGGGAGGGAAGG + Intergenic
1116290011 14:43022471-43022493 TGGAGGAAGGGAGGGAAGGAAGG - Intergenic
1116305453 14:43248102-43248124 TGGAAGAAAGAAAGGAAGGATGG - Intergenic
1116375834 14:44199537-44199559 GGGAAGAAGGGAGGGAAGGAGGG + Intergenic
1116676610 14:47914202-47914224 TTGAAGAAAGAGTGGAAAGAGGG + Intergenic
1116813254 14:49559983-49560005 TTAAAGAGGGAAGGGAAGGAGGG - Intergenic
1116898435 14:50339496-50339518 TTGAAGAAGGAAGAGAGGGAGGG + Intronic
1116933641 14:50715203-50715225 TTTAAGGAGGAAGGGGAGGATGG + Intergenic
1117359533 14:54959419-54959441 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
1117481092 14:56145520-56145542 TTGTAGAAGGAGTGGAAAGAAGG - Intronic
1117601977 14:57385540-57385562 TTGAGGATGGATGGGTGGGATGG + Intergenic
1118266555 14:64300366-64300388 TAGAGGTAGGATGAGAAGGAAGG - Intronic
1118614724 14:67567576-67567598 GTGAGGAAGGATGCCAAGGAGGG - Intronic
1118820528 14:69342460-69342482 TGGAAGAAGGAAGGAAGGGAGGG + Intronic
1118896133 14:69947128-69947150 AGGAAGAAGGAAGGGAGGGAGGG - Intronic
1119095168 14:71823359-71823381 AGGAAGAAAGAAGGGAAGGAGGG - Intergenic
1119334421 14:73820683-73820705 AGCAAGAAGGATGGGCAGGAAGG - Intergenic
1119513372 14:75229049-75229071 TGGAAGGTAGATGGGAAGGAGGG + Intergenic
1119794667 14:77385239-77385261 GATAGGAAGGATGGGAAGGAAGG - Intronic
1119989252 14:79176682-79176704 TTGAACATGAATGGGTAGGAGGG - Intronic
1120024196 14:79564015-79564037 TTAAAGAAGGAAGAGAAGTATGG + Intronic
1120052396 14:79882434-79882456 GACAAGAAGGAAGGGAAGGAGGG - Intergenic
1120762980 14:88302787-88302809 TTCAAGAAGGATGGGGTGGCTGG + Intronic
1120880705 14:89413640-89413662 TTGAAGAAGGTAAGGAAGAAGGG + Intronic
1121023468 14:90597293-90597315 TTGAATTAGTATTGGAAGGAGGG + Intronic
1121158171 14:91706972-91706994 TTGAGGAAGGATAGCAAGAATGG - Intronic
1121424959 14:93843808-93843830 TTGAAGCAGGGTGGGCAAGACGG + Intergenic
1121583964 14:95050238-95050260 AGGAAGAAGGAAGGGAAGGAAGG + Intergenic
1121612801 14:95293131-95293153 GGGAAGAAGGGAGGGAAGGAGGG - Intronic
1121676784 14:95760039-95760061 TTGCAGAGGGATGGGGAGGAAGG - Intergenic
1121741792 14:96257866-96257888 GGAAAGAAGGAAGGGAAGGAAGG + Intronic
1121800209 14:96768694-96768716 GGGAAGGAGGAAGGGAAGGAAGG - Intergenic
1122390304 14:101375683-101375705 CCAAAGAAGGATGGGAAGGGAGG + Intergenic
1122699502 14:103578262-103578284 TTGCAGAAGAATGGGAAGAATGG + Intronic
1124217057 15:27816216-27816238 TAGAAGAAGGAGGGGAGGGAGGG + Intronic
1124781702 15:32642255-32642277 TAGAAGAATGATTAGAAGGAGGG + Intronic
1124956226 15:34362329-34362351 ATGAAGAGGGATGGGATGGAGGG + Intronic
1125132909 15:36304757-36304779 ATGAAGTAGGATAGGAAGTAGGG + Intergenic
1125283021 15:38063320-38063342 TGGAAGAAGGATAGTAGGGAAGG - Intergenic
1125558564 15:40607652-40607674 TTAAAGAAGGTGGGGAAGGAAGG + Intronic
1125998853 15:44190252-44190274 TAGAAACAGGATGGGAAGCATGG + Intronic
1126370542 15:47941246-47941268 TGGAAGAAGGAAAGGAAGGAAGG + Intergenic
1126372211 15:47959507-47959529 TTATAGATGGAAGGGAAGGATGG - Intergenic
1126384473 15:48079946-48079968 TTGAAGAAGGTTGGGATGGCTGG - Intergenic
1126496381 15:49295156-49295178 GAGAAGAAGGAGGGGAAGGAGGG + Intronic
1126988563 15:54343615-54343637 TTGATGAAAGCAGGGAAGGAGGG - Intronic
1127126781 15:55819713-55819735 TTGGAGAGGGAAGGGCAGGAAGG - Intergenic
1127322554 15:57861746-57861768 TTTAAAAAGGAAAGGAAGGAAGG + Intergenic
1127402134 15:58599188-58599210 GGGAAGATGGAAGGGAAGGAAGG + Intronic
1127404959 15:58633943-58633965 GAGAAGATGGGTGGGAAGGAAGG + Intronic
1127576664 15:60298416-60298438 TGGAATATGGAGGGGAAGGAGGG + Intergenic
1127597079 15:60496089-60496111 TTGAAAAACGATGGATAGGAGGG - Intronic
1127689969 15:61385868-61385890 TGTAAAAAGGATGGGAGGGAGGG - Intergenic
1127788666 15:62378831-62378853 TTGAAGAAGGGAGGGAGGGAGGG + Intergenic
1127916480 15:63459361-63459383 TGGGAGAAGGACAGGAAGGAAGG - Intergenic
1127962264 15:63898669-63898691 AGGAAGGAGGGTGGGAAGGAAGG + Intergenic
1128209390 15:65884196-65884218 ATGAAAAAGGATGGGATGGGAGG + Intronic
1128660244 15:69495099-69495121 TAGAAGAAAGAAGGGAAGGGAGG - Intergenic
1128677992 15:69625846-69625868 AGGAAGAAGGAAGGGAGGGATGG - Intergenic
1128719731 15:69939637-69939659 TGGAAGAAGCCAGGGAAGGAAGG + Intergenic
1128722538 15:69961140-69961162 TAGAAGAGGGAAGGGAGGGAGGG + Intergenic
1128798600 15:70482328-70482350 TTAAAGCATCATGGGAAGGAAGG + Intergenic
1128912516 15:71529011-71529033 TTCAAGAAGGCTGGGAAATACGG - Intronic
1129040214 15:72679425-72679447 GGAAAGAAGGAAGGGAAGGAAGG + Intronic
1129207614 15:74046340-74046362 ATGAGTAGGGATGGGAAGGAGGG - Exonic
1129352347 15:74963594-74963616 TTGCAGGAGGAAGGGAAGGCAGG + Intronic
1129965525 15:79731714-79731736 ATGAAGGAGGAAAGGAAGGAAGG + Intergenic
1130175914 15:81570627-81570649 TTGGAGAAGGTGGGGAAAGAAGG - Intergenic
1130207417 15:81890034-81890056 TTGAAGAAGACAGGGAAGCAGGG - Intergenic
1130553865 15:84909350-84909372 TGGAAGAAAGAAAGGAAGGATGG - Intronic
1130791151 15:87157377-87157399 TGGAGGAAGGAAGGGATGGAAGG - Intergenic
1131066383 15:89437239-89437261 TGGAAGAAGGAGGGGACAGAGGG - Intergenic
1131067338 15:89442750-89442772 GTGAAGACTGAAGGGAAGGAAGG + Intergenic
1131251672 15:90834941-90834963 ATGAAGAGGGATAGGAAGGTTGG - Intergenic
1131264968 15:90910404-90910426 TAGAGGAGGGGTGGGAAGGAAGG + Intronic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131430817 15:92387592-92387614 TGGAAGAAGGGAGGGAAAGATGG - Intergenic
1131433973 15:92408474-92408496 TTGGAGAAAGAAGGGAAGGAAGG + Intronic
1131714183 15:95090651-95090673 AGGAAGAAGGGAGGGAAGGAGGG - Intergenic
1131727183 15:95239423-95239445 GAGAAGAAGGAAGGAAAGGAGGG + Intergenic
1131915852 15:97265422-97265444 TAGTAGAAGGATGGAAAGAAAGG - Intergenic
1131925893 15:97383414-97383436 AGGAAGAAGGAAAGGAAGGAAGG + Intergenic
1132057821 15:98665474-98665496 TTGAAGAAGGAAGAGACTGAAGG - Intronic
1132361226 15:101217599-101217621 GTGCAGAAGGAAGGGATGGAGGG + Intronic
1132755883 16:1485151-1485173 AGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1132918046 16:2364760-2364782 AGAAAGAAGGAAGGGAAGGAGGG + Intergenic
1133298968 16:4770218-4770240 TTGAAGAGGGATGTGATGGGGGG + Intergenic
1133326827 16:4947064-4947086 TGGAGGAAGGAAGGGAGGGAGGG - Intronic
1133333147 16:4988604-4988626 TGAAAGAAGGAAGGAAAGGAGGG - Intronic
1133429365 16:5723296-5723318 TTGGAGAAGCTTGGGATGGATGG + Intergenic
1133431621 16:5742178-5742200 TGGAGGAAGGAAGGGAAGGACGG - Intergenic
1133594017 16:7273054-7273076 TGGAAGGAGGGAGGGAAGGAGGG - Intronic
1133725243 16:8531039-8531061 GGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1134258882 16:12634543-12634565 TGAAAGAAAGATGGGAAAGAGGG + Intergenic
1134490783 16:14694037-14694059 TTGGAGAGGGATGGGAGGCAGGG + Intronic
1134496164 16:14733155-14733177 TTGGAGAGGGATGGGAGGCAGGG + Intronic
1134663056 16:15998579-15998601 GAGCAGAAGGAAGGGAAGGAAGG - Intronic
1134690210 16:16186187-16186209 TAAAAGAAGGATGGGGTGGAGGG + Intronic
1134866329 16:17610667-17610689 AGGAAGAAGGAAAGGAAGGAAGG - Intergenic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1135050016 16:19185152-19185174 GGGAGGAAGGAGGGGAAGGAGGG - Intronic
1135708024 16:24691784-24691806 TAAAAGAAGGAAGGGAGGGAGGG + Intergenic
1135805233 16:25536606-25536628 TTGTGGATGGATGGGAAGGCTGG + Intergenic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1136154639 16:28374675-28374697 TTGAAGAGGGATGGGAGGCAGGG - Intergenic
1136155552 16:28379884-28379906 TAGGAGAGAGATGGGAAGGAAGG + Intronic
1136207532 16:28735405-28735427 TAGGAGAGAGATGGGAAGGAAGG - Intronic
1136208452 16:28740583-28740605 TTGAAGAGGGATGGGAGGCAGGG + Intergenic
1136264541 16:29107259-29107281 TTGGAGAAGGATGGGAGGCAGGG + Intergenic
1136849717 16:33603186-33603208 GAGAGGAAGGATGGGAAGGGAGG - Intergenic
1137244229 16:46689454-46689476 GTCAAGAAGGAATGGAAGGAGGG + Intronic
1137342177 16:47619216-47619238 CTGAAGAATGAAAGGAAGGAGGG + Intronic
1137774077 16:51041095-51041117 AGGAAGAAGGAAGGAAAGGAAGG + Intergenic
1137802537 16:51274609-51274631 CTTAAGAAGGATGGGCAGGCTGG + Intergenic
1137932375 16:52601392-52601414 TTGAAGAGTGATGGGAACCATGG - Intergenic
1138248684 16:55485738-55485760 TTTGAGAAGGATGGCAAGTACGG + Exonic
1138364050 16:56458107-56458129 TTGAAGGAGGCTGGGAAGTGTGG - Intronic
1138458836 16:57136070-57136092 TGAAAGAAGGAAGGGAGGGATGG + Intronic
1138541597 16:57691036-57691058 GAGAAGAAGGAAGAGAAGGAAGG + Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1138705053 16:58906987-58907009 TATAGGATGGATGGGAAGGAAGG + Intergenic
1138746867 16:59373371-59373393 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1139047916 16:63085506-63085528 TAGAAGAAGGATGTCAGGGAGGG - Intergenic
1139131207 16:64148324-64148346 AGAAAGAAGGAAGGGAAGGAAGG - Intergenic
1139310378 16:66023473-66023495 GGGAGGAAGGGTGGGAAGGAAGG - Intergenic
1139725154 16:68891797-68891819 GGAAAGAAGGAAGGGAAGGACGG + Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140379117 16:74470385-74470407 TGGAAGGAGGGAGGGAAGGAAGG - Intronic
1140638423 16:76943776-76943798 GGGAAGAAGAAAGGGAAGGAAGG - Intergenic
1140780818 16:78294776-78294798 GGAAGGAAGGATGGGAAGGAGGG + Intronic
1140831045 16:78751733-78751755 TGAAAGAAGGAAAGGAAGGAAGG + Intronic
1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG + Intronic
1141293992 16:82749755-82749777 GTGAGGAAGGAAGGAAAGGAGGG - Intronic
1141581860 16:85004713-85004735 GTGAATAAGTAAGGGAAGGAGGG + Intronic
1141621513 16:85238827-85238849 TGGAGGAAGGACTGGAAGGAAGG - Intergenic
1141696389 16:85621801-85621823 TTGAAGAAGCAGGGGAGGGGAGG + Intronic
1141711547 16:85702396-85702418 GGGAGGAAGGAAGGGAAGGAAGG - Intronic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1142030650 16:87836806-87836828 TTGAAGGAGGAAAGGAGGGAAGG + Intronic
1142864043 17:2779684-2779706 TTGAAGGAGGAGTGGAGGGAGGG + Intronic
1143021245 17:3918109-3918131 AGGGAGAAGGAAGGGAAGGAAGG + Intergenic
1143490783 17:7284191-7284213 TGGGAGAAGGTTGGGAAAGAAGG - Intronic
1143701131 17:8660987-8661009 TAGAAGAAGGAAGGAAAGAAAGG - Intergenic
1143778540 17:9216596-9216618 TTTAAGGAGGATGGCCAGGAAGG + Intronic
1143856541 17:9855270-9855292 TTGCAGAAGAAGGGGAAGAAAGG + Intronic
1144094380 17:11886696-11886718 GTGAAGAGGGATGGGGATGATGG - Intronic
1144301174 17:13923927-13923949 TGAAAGAAGGAAGGGAATGAGGG + Intergenic
1144305549 17:13966635-13966657 TAAAAGAAGGAAGGGAATGAGGG - Intergenic
1144352895 17:14415800-14415822 TGGAGGGAGGAAGGGAAGGAGGG - Intergenic
1144352916 17:14415865-14415887 GGGAGGAAGGAAGGGAAGGAAGG - Intergenic
1144379091 17:14675236-14675258 TTGAACAAGGGTGGGAAATATGG - Intergenic
1144520940 17:15951838-15951860 CTGAAGGAGGCCGGGAAGGAGGG + Intronic
1144540082 17:16132904-16132926 AAGAAGAAGGAAGGGAGGGAGGG - Intronic
1144582302 17:16465857-16465879 TAGAGGCAGGATGGGAGGGAAGG + Intronic
1144670530 17:17130330-17130352 ATGAAGAAAGGAGGGAAGGAGGG - Intronic
1145274153 17:21420126-21420148 TTGCAGAAGGAAGGGAAGGCAGG - Intergenic
1145312015 17:21706025-21706047 TTGCAGAAGGAAGGGAAGGCAGG - Intergenic
1145783014 17:27576089-27576111 TTGAAGGAGGAGGGGAATGGGGG - Intronic
1146144470 17:30400971-30400993 TTCAAGAAGGATGGCAAGGCCGG - Intronic
1146193086 17:30787696-30787718 CTAAAGAAGTATGGGGAGGAGGG + Intronic
1146374497 17:32285108-32285130 TTGCAGAAGGGAGGGAGGGAGGG + Intronic
1146379052 17:32314998-32315020 GTGAGGAAGGATGGGGAGAAGGG + Intronic
1146434731 17:32833827-32833849 TTGAAGAAAGAATTGAAGGAAGG - Intronic
1146438595 17:32874266-32874288 AAGAGGAAGGAAGGGAAGGAAGG - Intronic
1146664059 17:34685185-34685207 TCCAAGAAGGAGGGGGAGGAGGG - Intergenic
1146801626 17:35828749-35828771 TTGAAGAGGTATGGGGCGGAGGG - Intronic
1147195980 17:38766934-38766956 TGGAAGAAGAGGGGGAAGGATGG + Exonic
1147275937 17:39316687-39316709 TTTAAGAAGAATGGGACGGCTGG + Intronic
1147501966 17:40974493-40974515 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147501980 17:40974551-40974573 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147563644 17:41523674-41523696 GGGTAGAGGGATGGGAAGGAAGG - Exonic
1147727363 17:42574642-42574664 GGAAAGAAGGATGGGAAGAAAGG - Intronic
1147947414 17:44087773-44087795 TGGAAGAAGGGAGGGAGGGAAGG - Intronic
1148182112 17:45613662-45613684 GCGAAGGAAGATGGGAAGGAGGG - Intergenic
1148192711 17:45691039-45691061 TTGATGAACGATGGGTGGGAAGG - Intergenic
1148247716 17:46045929-46045951 TTGAAGAAGGACAGGAAGCCCGG - Intronic
1148266747 17:46232034-46232056 GCGAAGGAAGATGGGAAGGAGGG + Intergenic
1148491915 17:48028731-48028753 GGGAAGAAAGATGGGAAGAAAGG + Intronic
1148562471 17:48613812-48613834 AGGAGGAAGGATGTGAAGGAGGG + Intronic
1148649403 17:49238875-49238897 TTGGGGAAGGCAGGGAAGGAGGG - Intergenic
1149024872 17:52016046-52016068 TTGGAGAAGGGTGGGATGGATGG + Intronic
1149479960 17:56995407-56995429 TAGGAGAAAGAGGGGAAGGAAGG - Intronic
1149639937 17:58195994-58196016 TGAAGGAAGGAAGGGAAGGAAGG - Intronic
1149676245 17:58465144-58465166 AGGAAGAAGGAAGGGAGGGAGGG - Intronic
1149965082 17:61154184-61154206 TTGAGGAAGGAAGGAAGGGAGGG + Intronic
1150272681 17:63876734-63876756 TGGAAGAAGGATGGTGAGGGAGG - Intronic
1150439046 17:65176964-65176986 TGGATGGAGGAAGGGAAGGAGGG - Intronic
1150984819 17:70184448-70184470 AGGAAGAAGGGAGGGAAGGAGGG - Intergenic
1150984869 17:70184572-70184594 AGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1151020606 17:70612715-70612737 TAGAACATGGATGGGAAAGAGGG - Intergenic
1151055428 17:71025670-71025692 TGGAAAAAGGAAGGGAAGAAAGG + Intergenic
1151354742 17:73551623-73551645 TTAAGGAAGGAGGGGAGGGAAGG - Intronic
1151355914 17:73558404-73558426 GTTAGGAAGGAAGGGAAGGAGGG + Intronic
1151804359 17:76396520-76396542 ATGGAGAAGGCTGGCAAGGACGG - Exonic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1153402485 18:4695914-4695936 TTGAAAAAAGATGAGAAGCATGG + Intergenic
1153486448 18:5603595-5603617 TTGAAGAAGGCTGGGCATGGTGG + Intronic
1153494098 18:5679934-5679956 GTGAAGAAGGGTTGGAGGGAAGG - Intergenic
1153800137 18:8661400-8661422 GGGAAGAAGGAAGGGAAGGAAGG + Intergenic
1154123081 18:11667243-11667265 TTCCAGAAGGATGGAAAGAAAGG + Intergenic
1154164934 18:12007740-12007762 AGAAAGAAGGAAGGGAAGGAAGG - Intronic
1154629727 18:16770117-16770139 ATGATGATGGATGGGATGGATGG + Intergenic
1155156399 18:23161477-23161499 TTCAAGAACTATGGGAGGGATGG - Intronic
1155231672 18:23780335-23780357 AGGAAGAAGGAAGGGAGGGAGGG + Intronic
1155762156 18:29582098-29582120 GAGAAGAAGGAAGGGAGGGAGGG + Intergenic
1156310592 18:35918593-35918615 ATGCAGAAGGATGGGCAAGAAGG + Intergenic
1156468489 18:37362704-37362726 TTGACACAGGATGGGGAGGAAGG - Intronic
1156713920 18:39983018-39983040 TGGAAGAAGGAAGAGAAGGAGGG + Intergenic
1157103160 18:44748188-44748210 GAAAGGAAGGATGGGAAGGAAGG + Intronic
1157165826 18:45357595-45357617 AAGAAGAAGGAAGGGGAGGAAGG + Intronic
1157956201 18:52100243-52100265 ATGAAGAAAGATGGGAAGGAAGG + Intergenic
1157978248 18:52350891-52350913 TTCAAGAAATATGGGAAGAAAGG - Intronic
1158159320 18:54462184-54462206 TGGAAGCAGGATGGCAAGGTAGG - Intergenic
1158186576 18:54778701-54778723 TGGAAGAAGAATGGAAAGGAAGG - Intronic
1158201982 18:54951351-54951373 CTGGAGAAGAGTGGGAAGGAGGG + Intronic
1158339896 18:56454735-56454757 TGGAAGGAGGGAGGGAAGGAAGG + Intergenic
1158793192 18:60807261-60807283 ATGAAGAAGGGAGGGAAGAAAGG - Intergenic
1158809867 18:61020127-61020149 TTGGAGAAGAGTGGGATGGATGG - Intergenic
1158979665 18:62747522-62747544 TTGAAGAAGGAAGCGAAGGAAGG - Intronic
1159029061 18:63212406-63212428 TTAAAGAAGGGAGGTAAGGAAGG + Intronic
1159119738 18:64154855-64154877 ATGAAGATAGAGGGGAAGGAAGG - Intergenic
1159960670 18:74553812-74553834 CTGAACACTGATGGGAAGGAAGG - Intronic
1159979182 18:74755539-74755561 AGGAAGAAGGAAGGGAGGGAGGG - Intronic
1160238175 18:77102146-77102168 TGGCAGCAGGGTGGGAAGGAGGG + Intronic
1160250243 18:77197198-77197220 TTAAAGAAGGTGGGGAAGGGAGG + Intergenic
1160293465 18:77616754-77616776 TTGCAGTAGGATTGGCAGGATGG - Intergenic
1160313352 18:77818619-77818641 AGGAAAAAGGAAGGGAAGGAAGG - Intergenic
1160313357 18:77818639-77818661 AAGAAGAAGGAAGGGAAGGAAGG - Intergenic
1160676427 19:393761-393783 GAGAAGGATGATGGGAAGGATGG + Intergenic
1160676704 19:394962-394984 GAGAAGGATGATGGGAAGGATGG + Intergenic
1160695402 19:481548-481570 GAGAAGGATGATGGGAAGGATGG + Intergenic
1160965689 19:1746077-1746099 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965720 19:1746158-1746180 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1161048552 19:2150374-2150396 TTGAAGAAGAATGGGCAGAGTGG - Intronic
1161776317 19:6264207-6264229 GGGAAGGAGGATGGGCAGGAGGG - Intronic
1161788916 19:6346869-6346891 TTCAAGAAGGAAGGAAAGAAGGG - Intergenic
1161854918 19:6758796-6758818 TGGGAGAAGGATGGGAAAAAAGG + Intronic
1161860245 19:6792507-6792529 TTGATCAAGCAAGGGAAGGAAGG + Intronic
1161919989 19:7258928-7258950 AGGAAGAAGGAAAGGAAGGAGGG - Intronic
1162058833 19:8082269-8082291 GAGAGGAAGGAAGGGAAGGAAGG - Intronic
1162153455 19:8661118-8661140 AGGAAGAAGGAAGGGAGGGAAGG - Intergenic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162232566 19:9279874-9279896 AGGAGGAAGGAAGGGAAGGAAGG + Intergenic
1162251160 19:9444702-9444724 GAGAAGAAGGAAGGGAAGAAAGG + Intergenic
1162357015 19:10192463-10192485 TTCAAGAAGGCTGGGCAGGCTGG + Intronic
1162769962 19:12943513-12943535 TGGAGGATGAATGGGAAGGATGG - Intronic
1162858920 19:13490903-13490925 AGGAAGAAGGAAGGGAGGGAGGG + Intronic
1162911859 19:13851841-13851863 TTTAAGAAGGATAGAAAGGTGGG - Intergenic
1162927098 19:13936170-13936192 TTGAGTAGGGATGGGGAGGAGGG - Intronic
1163347292 19:16751422-16751444 TGAAAGAAGGAAAGGAAGGAAGG + Intronic
1163703179 19:18797085-18797107 AGGAAGGAGGAAGGGAAGGAAGG - Intergenic
1163779766 19:19240107-19240129 GGGAAGAAGGATGGGGAGGAGGG - Intronic
1163812286 19:19441021-19441043 GGAAAGAAGGAAGGGAAGGAAGG - Intronic
1163816045 19:19465144-19465166 TTGAGGAAGGCTAGGCAGGAGGG - Intronic
1164122494 19:22279610-22279632 TTGAAGAAGGTTGGAATGAAAGG + Intergenic
1164434869 19:28220402-28220424 TGGAAGCAGGATCAGAAGGAAGG - Intergenic
1164546959 19:29173865-29173887 GTGGAAAAGGAAGGGAAGGACGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164706538 19:30324244-30324266 TGGATGATGGATGGGATGGATGG - Intronic
1164783340 19:30910808-30910830 TTAAAGAAAGATATGAAGGACGG - Intergenic
1164800659 19:31073586-31073608 GCAAAGAAGGAAGGGAAGGAGGG - Intergenic
1165132508 19:33641584-33641606 CTGAAGATGGAAGGGAAGAAGGG + Intronic
1165164052 19:33838978-33839000 TTGAGGGAGGATGGGGAAGAAGG + Intergenic
1165370204 19:35400674-35400696 GGAAAGAAGGAAGGGAAGGAGGG + Intergenic
1165371689 19:35411626-35411648 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1165373744 19:35426855-35426877 AAGAAGCAGGATGGGCAGGAGGG - Intergenic
1165705772 19:37975284-37975306 AGGAAGGAGGATGGCAAGGAGGG + Intronic
1165847388 19:38827042-38827064 AGGGAGAAGGAGGGGAAGGAGGG + Intronic
1166062439 19:40335012-40335034 GGGAAGGAGGAAGGGAAGGAGGG + Intronic
1166319049 19:42005320-42005342 TGTAAGATGGATGGGAAGGATGG - Intronic
1166335717 19:42105736-42105758 TTGCAGATGGATTGGATGGATGG - Intronic
1166337502 19:42117219-42117241 TTGGGGAAGGATGGGGACGAGGG - Intronic
1166529290 19:43533236-43533258 GGGAAGAAGGAATGGAAGGAGGG - Exonic
1166908419 19:46132691-46132713 AAGAAGAAGAAAGGGAAGGAGGG + Intergenic
1166908431 19:46132738-46132760 AAGAAGAAGAAAGGGAAGGAGGG + Intergenic
1166923797 19:46251513-46251535 TGGAAGCAGGGTGGGAAGGTTGG + Intergenic
1167139051 19:47636976-47636998 TTGACTAAGGAGGGGAAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167191889 19:47996164-47996186 TTAAAGAATGAAAGGAAGGATGG + Intronic
1167240875 19:48342330-48342352 AAGAGGAAGAATGGGAAGGAAGG + Intronic
1167240889 19:48342383-48342405 AAGAGGAAGAATGGGAAGGAAGG + Intronic
1167295557 19:48646893-48646915 GTGAAGGAGGAGGGGGAGGAGGG + Intergenic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1167616417 19:50536799-50536821 TTCTGGAAGGGTGGGAAGGAAGG + Intronic
1167626438 19:50592819-50592841 AGGAAGAAGGGAGGGAAGGAAGG - Intergenic
1167626485 19:50592982-50593004 GGGAGGAAGGAAGGGAAGGAGGG - Intergenic
1167682284 19:50931172-50931194 TTGAGGAAGGAAAGGAGGGAGGG - Intergenic
1167745635 19:51350124-51350146 TTCACGTAGGATGGCAAGGAAGG + Intronic
1168096677 19:54119790-54119812 TTCAAGAAGAATGGGAAGGCTGG - Intronic
1168109069 19:54181705-54181727 AGGAAGAAGGGAGGGAAGGAGGG + Intronic
1168464934 19:56594819-56594841 TGGAAGAAGGATGGAGGGGAAGG - Intergenic
1168508763 19:56957957-56957979 GAGAAGAAGGAAGGGAGGGAGGG + Intergenic
925222166 2:2150864-2150886 GGGAAGAAGGGAGGGAAGGAAGG + Intronic
925712009 2:6750308-6750330 GGGAAGAAGGAAGGGAGGGAGGG + Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926162669 2:10499864-10499886 CTGAAGAAGGAAGTGAAGGATGG + Intergenic
926173604 2:10569716-10569738 TTCAAGAAGGAAGGAAAAGAGGG + Intergenic
926339787 2:11895444-11895466 CTGAAAAAGGATGGGTAAGAGGG + Intergenic
926445055 2:12931342-12931364 TAGAAGAGGGATGGGGAAGATGG + Intergenic
926778742 2:16447761-16447783 TTGAAGAAGGAAGGAAGGGAGGG + Intergenic
926888663 2:17620297-17620319 TTTAAGTAGCATGGGTAGGATGG + Intronic
926992108 2:18691025-18691047 TTCATGAAGGATGGGAAGTGGGG - Intergenic
927132650 2:20073501-20073523 TTGAAAAATGATGGGAGGGATGG - Intergenic
927158547 2:20236463-20236485 AGGAAGGAGGGTGGGAAGGAAGG - Intergenic
927158558 2:20236496-20236518 GGGAAGAAGGGTGGGAAGGAAGG - Intergenic
927246246 2:20959168-20959190 TTGAAAAAGGATGGGAAACTGGG - Intergenic
927291432 2:21408553-21408575 TGGAGGAAGGAGGGGAATGAAGG + Intergenic
928166116 2:28973342-28973364 GGAAAGAAGGAAGGGAAGGAAGG - Intronic
928373782 2:30759185-30759207 GTAAAGAAGGAAGGGAGGGATGG - Intronic
928535217 2:32233209-32233231 AGGAAGAAGGAAGGGAGGGAGGG + Intronic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
929089597 2:38201737-38201759 TGGAGGAAGGGAGGGAAGGAAGG + Intergenic
929283741 2:40112668-40112690 AAAAATAAGGATGGGAAGGATGG + Intronic
929357391 2:41042104-41042126 TTGGAGAAAGATGGGGAGAATGG - Intergenic
929379969 2:41337937-41337959 CAGAATAAGGAAGGGAAGGAAGG + Intergenic
929786808 2:44999328-44999350 TTGCAGAAGGAGGGGAAAGAGGG + Intergenic
929899672 2:45989628-45989650 TTAAACAAGGAAAGGAAGGAAGG - Intronic
930030432 2:47055357-47055379 TTGAAGAAGGGAGGAGAGGAGGG - Intronic
930248258 2:49006818-49006840 TTGAGAAAGGATGGAAGGGATGG - Intronic
930414946 2:51079026-51079048 TTGAAGAATCAAGGGAATGAAGG + Intergenic
930551630 2:52841809-52841831 TGGAGGAAGGGAGGGAAGGAAGG + Intergenic
930564016 2:52996869-52996891 TAGTAGAAGGAAGAGAAGGAAGG + Intergenic
930774246 2:55157128-55157150 TTCAATTAGGAAGGGAAGGAAGG + Intergenic
931152014 2:59585026-59585048 AAGAAGAAGGAGGGGAAGGAGGG + Intergenic
931610443 2:64093438-64093460 TGAAAAAAGGGTGGGAAGGAGGG + Exonic
931825881 2:66000557-66000579 AGGAAGAAGGAAAGGAAGGAAGG + Intergenic
931871365 2:66463977-66463999 TTGAAGGGGGATGGGAAAGGTGG + Intronic
932033550 2:68215797-68215819 TTGAAGATGGAGGGGAAAGTGGG + Intronic
932271540 2:70414399-70414421 TTGAAGAAAGCTGGTAAGGAAGG + Intergenic
932423169 2:71613144-71613166 GTGAAGGAGGATGGGAGAGATGG + Intronic
932609086 2:73185411-73185433 TTGAAGAAGCCAAGGAAGGAAGG - Intergenic
932744876 2:74325838-74325860 AGGAAGAAGGAAGGGAAGGGAGG + Intronic
933794104 2:85906264-85906286 GGAAAGAAGGAAGGGAAGGAAGG - Intergenic
934650860 2:96090631-96090653 TTGAAAAATGTTGGGAAAGATGG - Intergenic
934847762 2:97673261-97673283 CTGAAGAAGGATGTGGAGCAAGG - Intergenic
935131524 2:100264663-100264685 GGGAAGAAGGAAGGGAAAGATGG - Intergenic
935174329 2:100635693-100635715 TTGAATAAGGGTGGTAAGAATGG + Intergenic
935438978 2:103069337-103069359 TGGAAGGAGGAAGGGAGGGAGGG - Intergenic
935469693 2:103443489-103443511 TAGCTGAAGGATAGGAAGGAGGG + Intergenic
935646965 2:105345531-105345553 TTAAAAAAGGAAGGGAGGGAGGG - Exonic
936444211 2:112583841-112583863 TTTAAGACAGATGAGAAGGAAGG + Intergenic
936562125 2:113549152-113549174 TGGAAGAAAGAAGGGAGGGAGGG + Intergenic
936589993 2:113794488-113794510 TGGAAGAAAGAAAGGAAGGAAGG + Intergenic
936616932 2:114057351-114057373 GGAAAGAAGGAAGGGAAGGAAGG - Intergenic
936894165 2:117407905-117407927 GGGAGGAAGGAAGGGAAGGAAGG - Intergenic
936894181 2:117407952-117407974 GTGAGGAAGGAAGGGAAGGAAGG - Intergenic
937065527 2:119013984-119014006 TTGAAGAAGAAGAGGAAGCAGGG + Intergenic
937248319 2:120508384-120508406 GTGGAGAAGGCTGGGAAGAAAGG + Intergenic
937327138 2:120996792-120996814 GAGAAGGAGGAGGGGAAGGAGGG - Intergenic
937509890 2:122583442-122583464 AAGAGGAAGGAAGGGAAGGAGGG + Intergenic
937530874 2:122825567-122825589 TAGAATGAGGATGGGAAAGAAGG - Intergenic
937619600 2:123970638-123970660 AGGAAGAAGGAAGGGAAGGAAGG + Intergenic
938671185 2:133588377-133588399 GGGAAGAAGGAAGGGAAGGAGGG - Intergenic
940470565 2:154093864-154093886 TTGATGGGGGATGGGAAGGAGGG - Intronic
940790525 2:158026050-158026072 ATGAAGAAGGCTGGAGAGGAAGG - Intronic
941052342 2:160749079-160749101 TTGAATGAGGATGGGTCGGAAGG - Intergenic
941158596 2:162008986-162009008 GGGAAGAGGGAAGGGAAGGAAGG - Intronic
941377669 2:164751399-164751421 TTGAGGAAGGAAGGGAGGGAAGG + Intronic
941568796 2:167142928-167142950 AGGAAGGAGGAAGGGAAGGAGGG + Intronic
941605231 2:167588925-167588947 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
941886125 2:170529432-170529454 AGGAAGAAGGAAGGGAGGGAGGG - Intronic
942008989 2:171739648-171739670 TTGAAGCAGGATCCAAAGGAGGG + Intronic
942148275 2:173048027-173048049 AGGAAGAAGGGAGGGAAGGAGGG + Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942595241 2:177586033-177586055 TGGAAGGAGGATGGGGAAGAAGG - Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942615033 2:177782845-177782867 AGAAAGAAGGAAGGGAAGGATGG - Intronic
942639987 2:178050605-178050627 TTGAAAAAAGATTGGAAGAATGG + Intronic
943180747 2:184537520-184537542 GGGAGGAAGGAAGGGAAGGAGGG + Intergenic
943720081 2:191194801-191194823 TGGAAGAAGGAAGGAAGGGAGGG - Intergenic
944186823 2:196958163-196958185 GAGAAGAAGGAAGGAAAGGAAGG - Intergenic
944684365 2:202105201-202105223 TGAAGGAAGGAAGGGAAGGAAGG + Intronic
944936279 2:204572302-204572324 TTGAAGGAGGAGGAAAAGGAGGG + Intronic
945032740 2:205680862-205680884 AGGAAGAAGGAAGGAAAGGAGGG + Intergenic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945307066 2:208268727-208268749 AGGAAGAAGAAGGGGAAGGAAGG - Intronic
945435281 2:209810552-209810574 TCCAAGAAGGATACGAAGGAGGG - Intronic
945493362 2:210481369-210481391 TTTCATAATGATGGGAAGGATGG + Intronic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946809880 2:223512451-223512473 TTGTGGAAGAAAGGGAAGGAGGG + Intergenic
947017936 2:225642097-225642119 TAGAGGAAGAAAGGGAAGGAAGG + Intronic
947030060 2:225783041-225783063 GTGAGGAAGGAAGGGAAGAAGGG - Intergenic
947134477 2:226963638-226963660 TGGAAGAAGGGTGAGAAGCAAGG - Intronic
947486647 2:230556150-230556172 TTGATAGAGGATGGGATGGATGG - Intergenic
948393064 2:237626588-237626610 CTGGGGAAGGATGGGAGGGAGGG - Intergenic
948584156 2:239008292-239008314 ATGAAGGAGGATGGAGAGGAAGG - Intergenic
948670582 2:239566209-239566231 GTGAAGAAGGCTGGGAAGGAAGG + Intergenic
1168810395 20:701057-701079 GTGAAGAAGGAATGGAAGGAAGG + Intergenic
1168848344 20:960115-960137 AAGAGGAAGGAAGGGAAGGAGGG + Exonic
1168899620 20:1352148-1352170 GGGAGGAAGGAAGGGAAGGAAGG - Intronic
1168974387 20:1953182-1953204 AAGAAGAAGGAAGGGAGGGAGGG + Intergenic
1169022761 20:2341805-2341827 TCGGGGAAGGAAGGGAAGGAAGG - Intergenic
1169125938 20:3126625-3126647 GTGAAGGAGGAAGGGAGGGAGGG + Intronic
1169173305 20:3484725-3484747 TTCCAGAAGGATGCGAAGGATGG - Intronic
1169184840 20:3605745-3605767 TTGGAGAGTGATGGGGAGGAAGG + Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169404935 20:5315250-5315272 TTGGAGTAGGGTGGGAAGGGCGG - Intergenic
1169476761 20:5938898-5938920 GGGAGGAAGGAAGGGAAGGAAGG - Intronic
1169513648 20:6293223-6293245 TGGATGAAGGAAGGGATGGATGG - Intergenic
1169539754 20:6586646-6586668 TGTAAGAAGGAAGGGAAGGAAGG + Intergenic
1169544323 20:6635237-6635259 TAGAGGAAGGAAGGGAGGGAGGG - Intergenic
1170095865 20:12645413-12645435 TGAAAGAAGGGTTGGAAGGAGGG + Intergenic
1170509024 20:17058001-17058023 GGGAAGAAGGAAGGGAAGGGAGG + Intergenic
1170915007 20:20614099-20614121 GTGAAGAAGGAAAGGAGGGATGG + Intronic
1171001542 20:21421221-21421243 TCGAGGAAGGAAGGGAGGGAGGG - Intergenic
1171083401 20:22212026-22212048 CTGGAGATGGATGGTAAGGATGG - Intergenic
1171409183 20:24934687-24934709 TTGAGGGTGCATGGGAAGGAAGG - Intergenic
1172110882 20:32544279-32544301 TGGAAGGATGATGGGAAGGCAGG + Intronic
1172216684 20:33240498-33240520 GGGAAAATGGATGGGAAGGAGGG + Intronic
1172898259 20:38315783-38315805 GGGAAGAAGGAAAGGAAGGAAGG - Intronic
1172939134 20:38642740-38642762 GTGAAGAAGGGAGGGAGGGATGG - Intronic
1172939536 20:38644926-38644948 TGGAAGAAGGAAGGGATAGAGGG - Intronic
1172970585 20:38870520-38870542 ATGCAGAAGGATGGGGAGGCTGG + Intronic
1173022466 20:39278463-39278485 TTCATGAAGGATGGGCAGGCAGG - Intergenic
1173149964 20:40558600-40558622 GTGAAGGAGAAAGGGAAGGAAGG + Intergenic
1173313137 20:41918037-41918059 AGAAAGAAGGAAGGGAAGGAAGG - Intergenic
1173344260 20:42184436-42184458 GGGAAGAAGGAAGGGAGGGAGGG - Intronic
1173563555 20:44023069-44023091 GGGAAAAAGGATGGGAAGGAGGG + Intronic
1173586593 20:44187305-44187327 TTGAAGAAGGCTGGGCTGGCTGG - Exonic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173870496 20:46338978-46339000 GTGGAGATGGATGGGGAGGAGGG + Intergenic
1173912608 20:46681433-46681455 AGGAAGAAAGAGGGGAAGGAGGG + Intronic
1173934537 20:46849841-46849863 TGGAAGAAGGAAGCAAAGGAGGG + Intergenic
1174008904 20:47433064-47433086 GTGAGGAAGGAAGGGAAGAAGGG + Intergenic
1174065758 20:47864339-47864361 TTAAGGAAAGATGGGAGGGAAGG - Intergenic
1174137562 20:48391061-48391083 TGGAAGGAGGGAGGGAAGGAAGG + Intergenic
1174692043 20:52515980-52516002 GGGAGGAAGGAAGGGAAGGAGGG + Intergenic
1174707051 20:52667688-52667710 TGGAAGAAGGATGGGAAAGGGGG - Intergenic
1174969769 20:55261832-55261854 TTGCAGCAGCATGGGAAAGAAGG + Intergenic
1175059680 20:56230537-56230559 GGGAAGAAAGAGGGGAAGGAGGG + Intergenic
1175480028 20:59304122-59304144 TTCAGGAAGGAAGGGAAGGAGGG - Intronic
1175983971 20:62755148-62755170 TAGAAGGAGGAAGGGATGGATGG - Intronic
1175984228 20:62755923-62755945 TGGAACAAGGGAGGGAAGGAGGG - Intronic
1176167856 20:63683421-63683443 GTGAAAATGGCTGGGAAGGAAGG + Intronic
1176221413 20:63970805-63970827 AGGAAGAAGGAAGGAAAGGAAGG - Intronic
1176221441 20:63970922-63970944 AGGAAGAAGGAAGGAAAGGAAGG - Intronic
1176939605 21:14908759-14908781 CTAAAGAAAGATAGGAAGGAAGG - Intergenic
1177497128 21:21903789-21903811 AGAAAGAAGGAAGGGAAGGAAGG + Intergenic
1177786350 21:25675538-25675560 GAGAGGAAGGAGGGGAAGGAAGG + Intronic
1178661417 21:34510590-34510612 TTTAAGGAGGATGGGAGGGGAGG - Intergenic
1178703487 21:34853793-34853815 TGAAGGAAGGAAGGGAAGGAAGG - Intronic
1178837627 21:36111891-36111913 GGGAAGAAGGAAAGGAAGGAAGG + Intergenic
1179000339 21:37451989-37452011 TTGAAGAATGGTGAGAAGGTCGG + Intronic
1179217522 21:39380469-39380491 CTTACGAAGGATGAGAAGGACGG - Exonic
1179553302 21:42156888-42156910 TGGAAGAAGGTTGGGGAGGCAGG - Intergenic
1179986593 21:44925398-44925420 AGGAAGAAGGAAGGGAGGGAGGG + Intronic
1181508458 22:23377637-23377659 ATGAAGAAGGAAGAGAAAGAAGG + Intergenic
1181547948 22:23614353-23614375 TGGAAGAGGGATGGCAAAGAAGG + Intronic
1181777270 22:25168748-25168770 TTTAAGAAGGATGGATAGGGAGG + Intronic
1182031578 22:27163230-27163252 AGGAAGGAGGAAGGGAAGGAAGG + Intergenic
1182033185 22:27176152-27176174 AGAAAGAAGGAAGGGAAGGAGGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182727071 22:32456399-32456421 TTGAGGGAGGGAGGGAAGGAGGG - Intronic
1182770630 22:32793629-32793651 TTGAAGGAAGGAGGGAAGGAAGG + Intronic
1182943492 22:34300518-34300540 CTGAAGAAGGAAGGAAGGGAAGG - Intergenic
1183081679 22:35460740-35460762 CTGCAGAAGGTTAGGAAGGAAGG + Intergenic
1183198517 22:36369745-36369767 TTGAAGTGGGATGAGAAGGCAGG + Intronic
1183387495 22:37523476-37523498 TTGAAGGAGGATTGGAAGGGGGG + Intergenic
1183698760 22:39438063-39438085 ACGAAGAAGGAAGGGAGGGAGGG - Intergenic
1183762746 22:39839414-39839436 TTGAACAAGGCTTTGAAGGACGG + Intronic
1183949107 22:41342874-41342896 TAGAAAAAGGATGGGTAGGCCGG + Intronic
1184053553 22:42027488-42027510 TTGAATGAGGATGGGAAGACAGG - Exonic
1184165900 22:42727583-42727605 ATGAAGAAGACAGGGAAGGAAGG - Intergenic
1184261937 22:43322640-43322662 TTGAAGGAGGAAAGGAGGGAGGG - Intronic
1184480306 22:44742885-44742907 TTTAATAAGGAAGGGAGGGAGGG + Intronic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1185104422 22:48859193-48859215 TGGATGGAGGATGGGAGGGAGGG - Intergenic
1185151606 22:49167117-49167139 GGGAGGAAGGAAGGGAAGGAGGG - Intergenic
1203297176 22_KI270736v1_random:51518-51540 GTGAAAAGGAATGGGAAGGAGGG + Intergenic
949262716 3:2121083-2121105 AGGAAGAAGGGAGGGAAGGAAGG - Intronic
949493158 3:4608492-4608514 CTCAAGAAGGATAGGGAGGAAGG + Intronic
949875785 3:8625220-8625242 ATGAGGAAGAAAGGGAAGGAGGG + Intronic
949880576 3:8657707-8657729 GTATAGAAGGAAGGGAAGGAGGG + Intronic
949947118 3:9199062-9199084 CTTAAAAAGGATGGGAAGGGGGG - Intronic
950461074 3:13122498-13122520 ATGAAGAAGGCAGGGAGGGAGGG + Intergenic
950726036 3:14917566-14917588 ATCAGGAAGGAAGGGAAGGAGGG + Intronic
950889738 3:16393223-16393245 TTAAAGATGGGTGGGAAGGTAGG + Intronic
951607274 3:24449973-24449995 ATGAGGAAGGAAGGAAAGGAGGG + Intronic
951870972 3:27362141-27362163 TTGAAGAAGGTCCAGAAGGATGG + Intronic
952623548 3:35376201-35376223 ATGAGGAAGGAAGGGAGGGAGGG + Intergenic
952949812 3:38513694-38513716 ATGAAGGAGAAAGGGAAGGAGGG - Intronic
952962557 3:38601861-38601883 ATCAACAAGGATGGGAAGGAAGG - Intronic
953043407 3:39274579-39274601 TTGAAGAGGAAAGGGAAGGGTGG - Intronic
953227688 3:41035428-41035450 GGGGAGAAGGAGGGGAAGGAGGG - Intergenic
953298819 3:41751008-41751030 GGGAAGGAGGGTGGGAAGGAGGG + Intronic
953406686 3:42663320-42663342 TTGGGGAAGGAAGGGCAGGATGG - Intronic
953472136 3:43176734-43176756 TGGAGGAAGGATGGGAGGGGAGG + Intergenic
954093894 3:48307420-48307442 TGGAAGAAGGAAGGGAGGAAAGG - Intronic
954094753 3:48317160-48317182 TCAAAGAAGGATGGGGAGAATGG + Intronic
954155966 3:48685181-48685203 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
954482281 3:50811407-50811429 GGAAAGAAGGAAGGGAAGGAGGG + Intronic
954911375 3:54113689-54113711 TTGAAAGAGGAGGAGAAGGAGGG - Intergenic
955443107 3:58978172-58978194 TGGAAGAAGGCTAGGAAGGAAGG - Intronic
955943468 3:64168728-64168750 TGGCAGATGGATGGGAAAGAAGG + Intronic
956161783 3:66362512-66362534 GTGAGGAAGGACAGGAAGGAGGG + Intronic
956313961 3:67913835-67913857 TAGAAGAAGGAGGAAAAGGAGGG - Intergenic
956550923 3:70458645-70458667 ATGTAGTAGGGTGGGAAGGAGGG + Intergenic
956555217 3:70513930-70513952 TTAAGGAAGGAAGGAAAGGAGGG + Intergenic
956557066 3:70535998-70536020 GGGAAGAAAGAAGGGAAGGAGGG - Intergenic
956643369 3:71435190-71435212 TGGAAGGAAGAAGGGAAGGAAGG + Intronic
956673576 3:71714232-71714254 GGGAAGAAGGAAAGGAAGGAAGG + Intronic
956767553 3:72496654-72496676 AGGAAGAAGGAAAGGAAGGAAGG - Intergenic
956961755 3:74411034-74411056 AGGAAGAAGGAAGGGAGGGAGGG - Intronic
957251350 3:77774760-77774782 TTGAAGAAGAATTGGAGGGTAGG - Intergenic
958479461 3:94628172-94628194 AGGAAGAAGGAAGGGAGGGAGGG - Intergenic
958632553 3:96701550-96701572 TGAAAGAAGGAAGGGAATGAGGG + Intergenic
958875951 3:99617418-99617440 GGCAGGAAGGATGGGAAGGAGGG + Intergenic
959089220 3:101884642-101884664 AGGAAGAAGGATGGAGAGGAAGG + Intergenic
959205224 3:103298403-103298425 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
959380024 3:105630579-105630601 ATGAAGAAGGGAGGGAAAGATGG - Intergenic
959697522 3:109264506-109264528 AGGAGGAAGGAAGGGAAGGAAGG + Intergenic
959714319 3:109416364-109416386 TTGAAGAAGAAAGGAAATGAGGG + Intergenic
959729659 3:109586342-109586364 AGGAAGAAGGAGGGGAATGAAGG - Intergenic
959903910 3:111689699-111689721 AAGAAGAAGGAGGGGAAAGATGG + Intronic
960203325 3:114864862-114864884 TTGAAGAAGTGTGGCAATGAAGG - Intronic
960307592 3:116080971-116080993 AGGAAGAAGGATGGGAGTGAAGG + Intronic
960496562 3:118382740-118382762 AGGAAGAAAGATGAGAAGGAGGG + Intergenic
960736837 3:120790405-120790427 TTGAAGTAGGATAGAATGGAAGG + Intergenic
960899638 3:122541956-122541978 TAGAAGTAAGATGGGGAGGATGG + Intronic
961080259 3:124020924-124020946 GTGAAGAAGGAAAGAAAGGAAGG + Intergenic
961115169 3:124323217-124323239 ATGAAAAAGGATGGGGAGGCTGG - Intronic
961187348 3:124927306-124927328 TTGAGGTAGGATGGGAGGGAAGG + Intronic
961799580 3:129436118-129436140 TGGAAAGAGGATGGGAAGAAGGG + Intronic
961957355 3:130817884-130817906 TTTAAAGAGGATGGGAAGAAGGG - Intergenic
962062549 3:131945587-131945609 AGGAAGAAGGTTGGGTAGGAAGG - Intronic
962195440 3:133358796-133358818 TAGAAGAGGGATGGGAAGGGAGG - Intronic
962790068 3:138803215-138803237 TTTAAAAAGGTTGGGAAGGGAGG + Intronic
962829619 3:139128573-139128595 TAGGAGGAGGAGGGGAAGGAGGG + Intronic
962844157 3:139260604-139260626 TTGTGGAAGGAAGGGAGGGAGGG + Intronic
962873508 3:139518464-139518486 GTGCAGAAGGGTGAGAAGGAGGG - Exonic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962914667 3:139888968-139888990 ATGAAGAAGGAAGGGAAGGAAGG - Intergenic
962922792 3:139965872-139965894 TTGAAGAAGAGTGGGAGAGAAGG - Intronic
963108395 3:141665563-141665585 AGGAAGAAGGAAGGAAAGGAGGG + Intergenic
963237147 3:142967035-142967057 GGAAAGAAGGAAGGGAAGGAAGG + Intronic
963257238 3:143157993-143158015 TTGAAGAAGGTGAGGAAGAAAGG - Intergenic
963534695 3:146513134-146513156 AGGAAGAAGGAGGGGAGGGAGGG - Intergenic
963618876 3:147578797-147578819 TGGAAGAAGGATGTGAAGAGGGG - Intergenic
964040194 3:152252238-152252260 GGGAAGGAGGAAGGGAAGGAGGG - Intronic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
964472176 3:157067546-157067568 TTAAAGGAGGTGGGGAAGGAAGG - Intergenic
964592076 3:158376159-158376181 GGGAAGAAGGAAGGGAGGGAGGG - Intronic
964677839 3:159303510-159303532 GGGAAGAAGGGAGGGAAGGAGGG + Intronic
964706724 3:159626439-159626461 TTCAAGAAACATGGGCAGGAAGG - Intronic
965300480 3:167000374-167000396 ATGAAGCTGGATAGGAAGGATGG + Intergenic
965611356 3:170547122-170547144 GAGAAGAAGGAAGGGAAAGAGGG - Intronic
965829323 3:172766446-172766468 CTGAAGAATGATTAGAAGGAAGG + Intronic
966102556 3:176289665-176289687 TTGAGGATGGAAGGGAAGCATGG - Intergenic
966273824 3:178141376-178141398 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
966836872 3:184056094-184056116 TTAAAGAAGAATGGAAAGGGTGG + Intronic
967679450 3:192343010-192343032 AGGAAGAAGGGAGGGAAGGAAGG + Intronic
968210664 3:196846074-196846096 TAGAAGATTGATGGGTAGGAAGG + Intergenic
968266980 3:197369924-197369946 AAGAAAAAGGAAGGGAAGGATGG - Intergenic
968312761 3:197697614-197697636 CTGAAGAAGGGAGGGAGGGAAGG + Intronic
968524269 4:1048037-1048059 GTGAAGAAGGCTGGAAAGGGTGG + Intergenic
968693475 4:2008634-2008656 CTGAAGGGGGATGGGAAGGTTGG + Intronic
968936447 4:3612787-3612809 GGGGAGAAGGATGGGATGGAGGG + Intergenic
968937042 4:3617056-3617078 GGGAAGAAGGGAGGGAAGGAGGG - Intergenic
969159235 4:5240984-5241006 TTGAAGAAGAACAGGATGGAAGG - Intronic
969173426 4:5381873-5381895 ATGAAGGAGGGAGGGAAGGAAGG + Intronic
969386572 4:6853771-6853793 GTTGAGAAGGATGGGAAGTATGG + Intronic
969481295 4:7448461-7448483 TGGAAGAAGGAAGGGAGAGAGGG - Intronic
970122165 4:12768191-12768213 GAGAAGAAGGAAGGGAAAGAGGG + Intergenic
970365111 4:15350285-15350307 GGGAAGAAGGAAGGAAAGGAGGG + Intronic
970452323 4:16181956-16181978 AAGATGAAGGATGTGAAGGATGG + Intronic
970690059 4:18611862-18611884 GTGAGGAAGGAAGGAAAGGAAGG + Intergenic
971434286 4:26603888-26603910 TTGAAGATGGATGGTGAGGATGG - Intronic
971567338 4:28161899-28161921 GGAAAGAAGGATGAGAAGGAGGG + Intergenic
971606758 4:28667787-28667809 TGAAAGAAGGAAGGGAGGGAGGG - Intergenic
972231369 4:37076078-37076100 TTGAAGAAGGAGCTGAAGGATGG - Intergenic
972264817 4:37449909-37449931 TAATAGAAGGATGGGGAGGAAGG + Intergenic
972542245 4:40049277-40049299 ATGATGATGGATGGGATGGATGG - Intergenic
972559654 4:40215499-40215521 TTAGAGAAGGAAGGAAAGGAAGG - Intronic
972751083 4:41990205-41990227 GGGAGGAAAGATGGGAAGGATGG - Intergenic
972785885 4:42326580-42326602 ATGAAGAAAGAATGGAAGGAAGG + Intergenic
972972492 4:44594319-44594341 TTGAAGAAAGATTGGACGAATGG + Intergenic
973009160 4:45050942-45050964 TTTGAGAAGGATGGCAAAGAGGG - Intergenic
973071886 4:45870635-45870657 TGAAGGAAGGAAGGGAAGGAAGG + Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973595938 4:52490282-52490304 GTAAAGAAGGAAGGGAAGGAAGG + Intergenic
973644599 4:52937379-52937401 TGGATGAAGGCTGGAAAGGAAGG + Intronic
973744323 4:53948369-53948391 TTGAAGAAGGACAGGAGAGAAGG + Intronic
973777152 4:54254184-54254206 ATGAAGAAAAATGGGAAAGATGG - Intronic
974020487 4:56688130-56688152 GGGAGGAAGGAAGGGAAGGAGGG + Intergenic
974425698 4:61740621-61740643 CTGAAGGAGGATGGGAAAGTAGG + Intronic
974920599 4:68234262-68234284 CTGAAGAATGATAGGAATGAGGG - Intronic
974963679 4:68734665-68734687 ATGAAGAAAGACAGGAAGGAAGG - Intergenic
975217215 4:71769757-71769779 AGGAAGCAGGGTGGGAAGGAGGG - Intronic
975441630 4:74418152-74418174 TTTAGAAAGGATTGGAAGGAAGG - Intergenic
975967595 4:79993361-79993383 AAGAAGGAGGAAGGGAAGGAAGG + Intronic
976147407 4:82055599-82055621 TTGAAGAAGTAAGACAAGGAAGG + Intergenic
976379338 4:84381633-84381655 TTGTGGAGTGATGGGAAGGAAGG - Intergenic
976753274 4:88471964-88471986 AGAAAGAAGGAAGGGAAGGAGGG - Intronic
977040298 4:92008139-92008161 TTGAAAAAGTCTGGGAAGGGAGG + Intergenic
977200764 4:94112838-94112860 AGGAAGAAGGAAGGAAAGGACGG + Intergenic
977245155 4:94622681-94622703 GTGAGGGAGGAAGGGAAGGAAGG - Intronic
977287486 4:95126683-95126705 TGGCGGTAGGATGGGAAGGAGGG + Intronic
977402484 4:96550251-96550273 TTTAGGAAGGTTAGGAAGGAAGG - Intergenic
977790927 4:101102214-101102236 ATGAAGAAGGAAAGAAAGGAGGG + Intronic
978297865 4:107228996-107229018 TAGAAGGAAGATAGGAAGGAAGG + Intronic
978546750 4:109879001-109879023 GGGTAGGAGGATGGGAAGGAAGG - Intergenic
978719587 4:111892320-111892342 TTAGACAAGGATGGTAAGGAAGG - Intergenic
978728594 4:111999242-111999264 TTGAAGGAGGGAAGGAAGGAAGG + Intergenic
978905348 4:113998676-113998698 CTGAACAGGGAAGGGAAGGAGGG - Intergenic
979333053 4:119438575-119438597 GGGAAGGAGGAAGGGAAGGAAGG + Intergenic
979371908 4:119898964-119898986 TTGGAGATAGAAGGGAAGGAAGG + Intergenic
980121335 4:128731320-128731342 GGGAAGAAGGAAGGGAGGGAGGG + Intergenic
980244060 4:130214952-130214974 TTGCAGAATGATGGGAAATATGG - Intergenic
980560805 4:134472416-134472438 GGGAAGAAGGAAGGAAAGGAAGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981601263 4:146491638-146491660 GTGAAGAAAGAAAGGAAGGAGGG + Intronic
981614675 4:146634326-146634348 TGGAAGAAAGAGGGAAAGGAGGG - Intergenic
981676703 4:147350913-147350935 GATAAGAAGGAAGGGAAGGAGGG + Intergenic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982183613 4:152774026-152774048 GGGAGGAAGGAAGGGAAGGAAGG - Intronic
982596727 4:157395043-157395065 AGGAAGAAAGATGGGAGGGAGGG + Intergenic
982708642 4:158737460-158737482 GTAAAGAAGGAAGGGAGGGAGGG + Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
982990406 4:162266461-162266483 TTGCAGAAGGATGGGGTAGAAGG - Intergenic
983021663 4:162684416-162684438 CTGAAAGAGGAGGGGAAGGAAGG + Intergenic
983594424 4:169449927-169449949 TTGAAGAAAGATTAGAAGAATGG + Intronic
983928940 4:173432422-173432444 AGGAAGAAGGAGGAGAAGGAAGG - Intergenic
984226982 4:177046889-177046911 TTCAATAAGGATGAGAAGAAAGG + Intergenic
984238421 4:177189414-177189436 TGGAAGAAGGGAGGGAGGGAGGG - Intergenic
984460830 4:180034629-180034651 TGGAGGGAGGAAGGGAAGGAGGG + Intergenic
984494932 4:180484692-180484714 TTGAAGGAAGAAAGGAAGGAAGG - Intergenic
984632710 4:182077567-182077589 TAGAGGAAGGAAGGGCAGGAAGG + Intergenic
984731082 4:183068876-183068898 GTGAAGGAGAAAGGGAAGGAAGG + Intergenic
984742754 4:183182936-183182958 TGGAAGAAGAGTAGGAAGGAAGG - Intronic
984837105 4:184032473-184032495 ATGAAGAAGGAAGGGAGGGAGGG - Intergenic
985106935 4:186509330-186509352 AGGAAGAAGGAAGGGAGGGAGGG + Intronic
985167235 4:187109668-187109690 TTGAAGAAGAGTGGGAAAAATGG + Intergenic
985435881 4:189929133-189929155 GTGAAGAAGGCTGGGATGAAGGG - Intergenic
985478997 5:95586-95608 TAGAATAAGGCTGGGAAGGGAGG - Intergenic
985547916 5:519302-519324 TTGAAGAAGCATAGGAAAGGAGG - Intronic
985625966 5:987843-987865 GGGAAGGAGGAAGGGAAGGAAGG + Intergenic
985680401 5:1252954-1252976 GTGAGGCAGGAGGGGAAGGAGGG - Intergenic
985709243 5:1419038-1419060 TGGATGATGGATGGGATGGATGG - Intronic
985864741 5:2505569-2505591 ATGAAAAATGATGGGAAAGAAGG + Intergenic
986015226 5:3751741-3751763 AAGAAGAAGGGAGGGAAGGAAGG + Intergenic
986313358 5:6571084-6571106 GGGAAGGAGGGTGGGAAGGAGGG + Intergenic
986313582 5:6571723-6571745 GGGAAGGAGGGTGGGAAGGAGGG + Intergenic
986365061 5:7021429-7021451 TGAAAGAAGGAAGGGAATGAGGG - Intergenic
986501133 5:8401041-8401063 GTGAAGATGGATGGTGAGGAGGG + Intergenic
987001539 5:13664848-13664870 AAGAAGGAGGATGAGAAGGAGGG + Intergenic
987068931 5:14317650-14317672 GTGAAGAATGATGAGAATGATGG - Intronic
987447885 5:18043712-18043734 ATGAAGAAGGAGGGGAGGGGAGG - Intergenic
987602948 5:20095533-20095555 GGAAAGAAGGAAGGGAAGGAAGG + Intronic
987909514 5:24123396-24123418 TGGAAGATGAATGGGAAGAAAGG + Intronic
987917935 5:24240365-24240387 TTGAAGGAGGGAAGGAAGGAAGG + Intergenic
987960343 5:24799315-24799337 CTAAAGAAGGAAGGGAGGGAAGG - Intergenic
987982119 5:25099273-25099295 TTGAGGAGGGACAGGAAGGAAGG - Intergenic
988064906 5:26220424-26220446 TTCAAGAAGGATGGGAGGCTGGG + Intergenic
988222549 5:28367987-28368009 ATGAAGAAAGAAGGGAAGAAAGG - Intergenic
988490843 5:31704001-31704023 GGAAAGAAGGAAGGGAAGGAAGG - Intronic
989278008 5:39610974-39610996 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
990050795 5:51497387-51497409 GTGGAGAGGGATGGGCAGGAAGG - Intergenic
990477040 5:56171529-56171551 TTAAAGTAGCATGGGAGGGAGGG - Intronic
990495285 5:56341359-56341381 AGAAAGAAAGATGGGAAGGAAGG - Intergenic
990658741 5:57988203-57988225 GTGAGGAAGGAAAGGAAGGAGGG - Intergenic
990865454 5:60375050-60375072 TTCAAGAAGGAGGGCAAGGTTGG - Intronic
991021690 5:61985883-61985905 TTGAATGAGGAAGGGAAGGAAGG + Intergenic
991449407 5:66736149-66736171 ATGAATAAAGATGGAAAGGAAGG - Intronic
991511032 5:67376409-67376431 GGAAAGAAGGATGGGAAGAAGGG - Intergenic
991920649 5:71653371-71653393 TTGAAGAAAGATGTGAAAGCAGG - Intronic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992031830 5:72728845-72728867 TTGAAAAAAGATGAGAAGAATGG + Intergenic
992314798 5:75541487-75541509 GTGAAGAAGAATGGGACAGAGGG - Intronic
992715675 5:79509189-79509211 TTGGGGAAAGAGGGGAAGGAAGG + Intronic
992748542 5:79841648-79841670 TGAAACAAGGAAGGGAAGGAGGG + Intergenic
993283539 5:85959891-85959913 TGGAAGGAGGGAGGGAAGGAAGG - Intergenic
993681665 5:90885856-90885878 ATGAAGAAGAAAGGGAAGGAGGG + Intronic
993795732 5:92265682-92265704 ATATAGATGGATGGGAAGGAAGG + Intergenic
993949457 5:94155597-94155619 AGGAAGAAGGAGGGGAAGTATGG + Intronic
993959476 5:94279551-94279573 TAGAAAAAGAATGGGAAGAAAGG - Intronic
994022165 5:95040146-95040168 TTAAAGAAGGCTGGGCATGATGG + Intronic
994084517 5:95743681-95743703 GAGAAGAAGGGAGGGAAGGAGGG - Intronic
994218954 5:97172408-97172430 TTGGATATGGATGTGAAGGAAGG - Intronic
994252994 5:97558875-97558897 TTGGAGAAGGAAGAGAAGGCTGG + Intergenic
994294727 5:98077366-98077388 TTGAAGAATGATCTGAAGGCTGG + Intergenic
994913690 5:105945648-105945670 GAGAGGAAGGATGGGAGGGAGGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995298994 5:110556281-110556303 GAGGAGAAGGAAGGGAAGGAAGG - Intronic
995722965 5:115155768-115155790 TTGAAGAAGGGTGGTAAGAGTGG - Intronic
995865703 5:116688257-116688279 GGGAGGAAGGAAGGGAAGGAAGG - Intergenic
995876464 5:116795318-116795340 TTGAAGTAGGAGGGGAACAAAGG - Intergenic
995910361 5:117179612-117179634 ATGAAGAAGCAGGGGAAGCAGGG + Intergenic
996169556 5:120272525-120272547 GGGAAGAAGGAAGGAAAGGAAGG + Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996847934 5:127921215-127921237 TGGAGGAAGGAAGGGAAGAAAGG + Intergenic
996898909 5:128520962-128520984 ATAAAGATGGATGGGAAGGTGGG + Intronic
997001373 5:129766130-129766152 TTCTAGAAGGAAGGGCAGGATGG - Exonic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997757167 5:136410074-136410096 TTGAAGATGCTAGGGAAGGAGGG + Intergenic
997763335 5:136472428-136472450 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
997848659 5:137311301-137311323 TTGTTGAGGGGTGGGAAGGAGGG + Intronic
998108988 5:139486722-139486744 TGGAAGGAGGATGGGAGTGATGG + Intergenic
998314005 5:141163074-141163096 TTCAGTAAGGATGGGTAGGATGG + Intergenic
998344845 5:141452744-141452766 AGGAAGAAGGAAGGGAGGGAGGG + Intronic
998600645 5:143581576-143581598 TTTCATAAGGATGGGAATGAGGG + Intergenic
998678888 5:144442515-144442537 TGGAAGGAGGGAGGGAAGGAGGG - Intronic
998856670 5:146400803-146400825 TAGAATCAGGGTGGGAAGGATGG - Intergenic
999185623 5:149706235-149706257 TAGTAAAAGTATGGGAAGGAGGG - Intergenic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999496467 5:152103733-152103755 TCCAAGAAGGAAGGGAAAGAGGG - Intergenic
999635511 5:153617875-153617897 TTGAAGGTGGAGGGGAAGGTGGG - Intronic
999863800 5:155678813-155678835 TGAAAGAAGGAAGGGAATGAAGG + Intergenic
1000210568 5:159103629-159103651 AGAAAGAAGGAAGGGAAGGAAGG + Intergenic
1000294249 5:159899214-159899236 TAAAAGAAGGAAGGGAAGGAGGG + Intergenic
1000456131 5:161451690-161451712 ATGAAGAATGATGGTGAGGAGGG + Intronic
1000696181 5:164387196-164387218 GGGAAGGAGGATGGGAGGGAGGG + Intergenic
1000984903 5:167855873-167855895 GGGAGGAAGGAAGGGAAGGAGGG + Intronic
1001052068 5:168421616-168421638 TGGAGGAAGGAAGAGAAGGAGGG + Intronic
1001280713 5:170384406-170384428 TTGAGCCAGGATGGGAAAGATGG + Intronic
1001310045 5:170604046-170604068 TTGAAGTAGGATGGAGAGGAAGG + Intronic
1001793474 5:174481914-174481936 GGAAAGAAGGAAGGGAAGGAAGG + Intergenic
1002193516 5:177490700-177490722 AGGAAGGAGGAAGGGAAGGAAGG + Intronic
1002382669 5:178841380-178841402 TTGGAGAAGGAGAGGAAGAAGGG - Intergenic
1002550515 5:179987150-179987172 TAGAAGAAAGAAAGGAAGGAAGG - Intronic
1002913852 6:1512514-1512536 AGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1003121608 6:3322917-3322939 ATGGAGAGGGATGGGAAGGAAGG + Intronic
1003403390 6:5809316-5809338 TTGAAGGAAGGAGGGAAGGAAGG + Intergenic
1003541512 6:7022446-7022468 TGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1004001481 6:11600812-11600834 AGGAAGAAGAATGGGAAGAAGGG - Intergenic
1004001485 6:11600832-11600854 TGGAAGGAGGACGGGAAAGAAGG - Intergenic
1004131248 6:12921790-12921812 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
1004406509 6:15338225-15338247 TGAAAGAAGGAAGGGAATGAGGG + Intronic
1004446976 6:15709484-15709506 TTGAAGAAGGGTAGGAAGCAAGG - Intergenic
1004469193 6:15913750-15913772 AGAAAGAAGGATGGAAAGGAAGG + Intergenic
1004681726 6:17902266-17902288 TTGGAGAATGAAGGGGAGGATGG - Intronic
1004751326 6:18565587-18565609 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1004751425 6:18565973-18565995 AGGAAGAAGGAAGGGAAGGAGGG - Intergenic
1004775359 6:18838075-18838097 CTCAGGAAGGATGGGAAGGATGG + Intergenic
1004784617 6:18953134-18953156 GGAAAGAAGGAAGGGAAGGAAGG + Intergenic
1004791224 6:19028660-19028682 TTGAAGAAAGATTGTAAGGAAGG + Intergenic
1005365330 6:25070449-25070471 TTCAGGAAGGAAGGGAAGGAAGG + Intergenic
1006139796 6:31921399-31921421 TTTGAGAAGGATGGAAAAGAAGG + Intronic
1006365769 6:33614300-33614322 TAGAAGATGGAGGGGAAAGAAGG + Intergenic
1006463327 6:34176704-34176726 CAGAGGAAGGATGGGAGGGAGGG + Intergenic
1006868318 6:37227365-37227387 GGGAAAAAGAATGGGAAGGAAGG - Intronic
1006887126 6:37391263-37391285 TGGGAGCAGGAAGGGAAGGAAGG - Exonic
1006965324 6:37977859-37977881 AGGAAGAAGGAAAGGAAGGAAGG - Intronic
1007104101 6:39271651-39271673 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1007166693 6:39833304-39833326 ATCAGGAAGGAAGGGAAGGAAGG - Intronic
1007636365 6:43302147-43302169 CCAAAGAGGGATGGGAAGGAGGG + Intronic
1007724231 6:43905188-43905210 AGGAAGGAGGAAGGGAAGGAGGG - Intergenic
1007808871 6:44472500-44472522 CTGAAGCAGGATGGGAGGGGAGG - Intergenic
1008227073 6:48934036-48934058 TAAAAGAAAGATAGGAAGGAAGG - Intergenic
1008416357 6:51245355-51245377 TTAGAGTTGGATGGGAAGGATGG + Intergenic
1008700932 6:54098478-54098500 TTGAAGGAGGAGGGGAAGCAGGG + Intronic
1008757710 6:54817418-54817440 TGGAAGAAGGATGACAAGGCAGG - Intergenic
1008828693 6:55731313-55731335 TAGAAGATGGAAGGCAAGGATGG + Intergenic
1008838720 6:55870506-55870528 TTGAAGGGGGATGGGTTGGAAGG - Intronic
1009461489 6:63919416-63919438 TTGAAGAAGGATGTGTGGGTTGG - Intronic
1009530525 6:64807961-64807983 AGGGAGAAGGAAGGGAAGGAAGG - Intronic
1009659126 6:66587045-66587067 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
1009713449 6:67355191-67355213 TTGAAGAAGTATGTGACAGAAGG + Intergenic
1009843000 6:69100868-69100890 AGGAAGAAGGAAGGGAGGGAAGG + Intronic
1009884994 6:69615566-69615588 AGGAAGAAGGAACGGAAGGATGG + Intergenic
1010056240 6:71568655-71568677 ATGAGGAAGAATGGGAAGGAGGG + Intergenic
1010168169 6:72941534-72941556 GGGAAGAAGGAAAGGAAGGAGGG - Intronic
1010364366 6:75032093-75032115 TTGAAAAAGGATTAGAAGAATGG + Intergenic
1011555236 6:88566467-88566489 TTGATGAATGGTAGGAAGGAAGG + Intergenic
1011654548 6:89538693-89538715 TTGAAGTATGGTGGGAAGTATGG + Intronic
1011756484 6:90503458-90503480 TTGAGGAGAGATGTGAAGGAAGG - Intergenic
1011816796 6:91201024-91201046 TTGAAGAGGGCTGGGTAGAATGG + Intergenic
1011949343 6:92944839-92944861 AGGAAGGAGGAAGGGAAGGAGGG + Intergenic
1012595713 6:101036226-101036248 TAGAGGAAGGAAGGGAAAGAGGG - Intergenic
1012607020 6:101170168-101170190 TAGAGGAAGGAAGGGAGGGAGGG - Intergenic
1012635881 6:101541022-101541044 TTGAGGAAAGATGGGAATCATGG + Intronic
1012734208 6:102918108-102918130 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1012797235 6:103777784-103777806 CTGAAGAAAGATGGGCAGAATGG - Intergenic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1012994724 6:105961724-105961746 GAGAAGAAGGGAGGGAAGGAGGG + Intergenic
1013046676 6:106492536-106492558 GGGAAGAAGGAAGGAAAGGAAGG + Intergenic
1013533380 6:111040739-111040761 AGGAGGAAGGAAGGGAAGGAAGG + Intergenic
1013751396 6:113410798-113410820 GAGAAGAAGGAAGGGAGGGAGGG + Intergenic
1014095668 6:117457908-117457930 ATGAAGAAGTAAGGGAAGGCTGG - Intronic
1014412650 6:121146058-121146080 TTGAAGACTGATGTGAAGGATGG + Intronic
1014719456 6:124898347-124898369 ATGAAGTGGGATGGGAAGGAAGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1014999794 6:128200875-128200897 AGGAAGAAGGGAGGGAAGGAGGG + Intronic
1015189147 6:130454520-130454542 TTGATGAAGGTGGGGTAGGATGG - Intergenic
1015276647 6:131389190-131389212 TTAAAGCAGGCTGGCAAGGAGGG + Intergenic
1015280026 6:131423133-131423155 GTGAAGAAGGAAGGAAAGGCAGG - Intergenic
1015631522 6:135236540-135236562 AGGAAGAAGGGAGGGAAGGAGGG - Intergenic
1015685675 6:135856981-135857003 GGAAAGAAGGAAGGGAAGGAGGG - Intronic
1015770318 6:136761849-136761871 ATGGAGAAGGAAGGGAAGAAGGG + Intronic
1015812733 6:137177473-137177495 TGGATGAAGGGTGGGAGGGAGGG - Intergenic
1015935346 6:138402834-138402856 TTCAAGAGAAATGGGAAGGAGGG - Intergenic
1016060765 6:139627484-139627506 TGGAACAGGGCTGGGAAGGAGGG - Intergenic
1016396651 6:143630992-143631014 TTGAAGAAGGGAGAGAAGAAAGG - Intronic
1017744591 6:157435354-157435376 TAGGAGAAGGGAGGGAAGGAGGG + Intronic
1017876196 6:158526218-158526240 GTGAAGAAGAATGTGAAGGCTGG + Intergenic
1017978967 6:159381933-159381955 TTGAAGAGGGATAGAAAGAATGG + Intergenic
1018335041 6:162777863-162777885 AGGAAGGAGGGTGGGAAGGAAGG - Intronic
1018352541 6:162975840-162975862 TTGTGGAAGGAAGGGAGGGAGGG - Intronic
1018497935 6:164369270-164369292 GTGAAGCAGGATAGGAAAGAGGG + Intergenic
1018576579 6:165266164-165266186 TTGAGGAAGGATGGGCTAGATGG + Intergenic
1018610001 6:165639018-165639040 GGGAAGAAGGAAGGGAGGGAAGG + Intronic
1018726463 6:166616641-166616663 GGGAGGATGGATGGGAAGGATGG - Intronic
1018816794 6:167338930-167338952 AGGAAGGAGGAAGGGAAGGAAGG - Intronic
1019091846 6:169543046-169543068 TGTAAGAAGAATGAGAAGGAAGG + Intronic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019288898 7:237716-237738 GTGATGAAGGATGGTAATGATGG + Intronic
1019531680 7:1506548-1506570 GAGAAGAAGGAAGGGGAGGAGGG - Intergenic
1019742108 7:2680173-2680195 TTGAAGAAGGAGGGCAGGGCTGG + Intronic
1019941871 7:4298262-4298284 TTGAAGAAAGAAGGGAAGGATGG - Intergenic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1020128905 7:5548765-5548787 AGGAAGGAGGAAGGGAAGGAAGG + Intronic
1020173829 7:5866443-5866465 GGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1020434895 7:8152061-8152083 TAGAAGAGGGCTGGGAAGGCCGG - Intronic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1021555622 7:21915130-21915152 CTGCAGAGGGAAGGGAAGGATGG + Intronic
1021894237 7:25219192-25219214 TTTTAGAAGGAAGGGAGGGAGGG - Intergenic
1021971081 7:25966676-25966698 GGGAAGGAGGATAGGAAGGATGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022194228 7:28048991-28049013 GGGAGGAAGGAAGGGAAGGAAGG - Intronic
1022205339 7:28158363-28158385 TTCCAGAAGGAAGGGCAGGAAGG - Intronic
1022278737 7:28883321-28883343 GGGAAGAAGGAAAGGAAGGAAGG - Intergenic
1022521998 7:31014405-31014427 ATGAAGAAGGATGGGCAGAAGGG - Intergenic
1022566893 7:31412877-31412899 ATGAAGAAGGAGGGAAAGGAAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022875709 7:34526796-34526818 TAAAAGGAAGATGGGAAGGAAGG - Intergenic
1023133158 7:37024028-37024050 TGGATGAAGGAAGGGAGGGAAGG - Intronic
1023279899 7:38558568-38558590 AGGAATAATGATGGGAAGGAGGG + Intronic
1023685747 7:42733308-42733330 GTGAAGATGGCTGGGAAGCAAGG + Intergenic
1024051066 7:45623796-45623818 TCGAAGAGGGAAGGGGAGGAGGG + Intronic
1024148109 7:46537691-46537713 TTGATGAAAGATGGTAAGAAGGG + Intergenic
1024235727 7:47396229-47396251 GTGAAGGAGGAAAGGAAGGAAGG - Intronic
1024833364 7:53487640-53487662 AGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1024833376 7:53487681-53487703 AAGAAGAAGGAAGGAAAGGAAGG - Intergenic
1025117025 7:56267103-56267125 GGGAGGAAGGAAGGGAAGGAAGG - Intergenic
1025869338 7:65416021-65416043 TTGAAAAAGGATTAGATGGATGG + Intergenic
1026002966 7:66577063-66577085 ATGAATGAGGAAGGGAAGGAGGG + Intergenic
1026007417 7:66610992-66611014 GGGAAGAAGGAAGGAAAGGAGGG + Intergenic
1026222240 7:68410387-68410409 AGGAAGAAGGAAGGGAAGGAGGG + Intergenic
1026401793 7:70021410-70021432 GTGAAGCTGGATGGGAGGGAAGG + Intronic
1026539184 7:71265527-71265549 TTGCACAAGGAGGGCAAGGAAGG + Intronic
1026636681 7:72088772-72088794 TAAGAGAAGGAAGGGAAGGAAGG + Intronic
1026865033 7:73818453-73818475 GGAAAGAAGGAAGGGAAGGAGGG - Intronic
1026927362 7:74203925-74203947 TAGAAGAAGGAAGGAAAGGAAGG + Intronic
1026960456 7:74404379-74404401 TTGAAGAAGGTTCAGAAGGTGGG - Exonic
1027572074 7:79882186-79882208 ATGGAGAAGGAGGGGAAGAAGGG - Intergenic
1027592253 7:80132445-80132467 GTGAAGAATGATGGGATGTATGG - Intergenic
1027856251 7:83515466-83515488 TCTAAGCAGCATGGGAAGGATGG - Intronic
1028166963 7:87548346-87548368 TTGAGGGAGGGAGGGAAGGAAGG + Intronic
1028295377 7:89123197-89123219 TTGTAGAAGGAAGGGAAGAAGGG + Intronic
1028451798 7:90993511-90993533 TGAAAGAAGAAGGGGAAGGAAGG + Intronic
1028843317 7:95452145-95452167 TTGGAGCAGAATGGGAATGAGGG - Intergenic
1029087024 7:98019779-98019801 AAGAAGAAAGAAGGGAAGGAAGG - Intergenic
1029191568 7:98775833-98775855 GGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1029216619 7:98955056-98955078 TTTATGGAGGATGAGAAGGAAGG - Intronic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029412859 7:100426883-100426905 AGGAAGAAGGAGGGGAAGCAGGG - Intronic
1029634150 7:101772778-101772800 GGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1029646190 7:101857608-101857630 GTGAAGCAGGAAGGGAAAGACGG + Intronic
1029849637 7:103448356-103448378 TAAAAGAAGGAAGGCAAGGAAGG - Intergenic
1030103014 7:105962694-105962716 TCGAAGAAGGCTGTGAAGGAAGG - Intronic
1030301306 7:107977113-107977135 ATGGAGAAGGAAGGGAGGGAGGG - Intronic
1030394789 7:108972310-108972332 TTCAAGAAGGTTGAGAAGGTTGG - Intergenic
1030497141 7:110314440-110314462 GTGAACAAGGAGGGGAAGGGAGG - Intergenic
1030722177 7:112883288-112883310 GGAAAGAAGGATGGAAAGGATGG - Intronic
1031137832 7:117904504-117904526 TTGAATAAGAAAGGGCAGGAAGG + Intergenic
1031605678 7:123764258-123764280 TTGAAGGAGGCTGGGCACGATGG - Intergenic
1031620335 7:123927401-123927423 CTGAAGTAGCATCGGAAGGAGGG + Intronic
1031970127 7:128058830-128058852 TTAAGGAAGGAGGGGAGGGAAGG - Intronic
1032378507 7:131449695-131449717 GGGAAAAAGAATGGGAAGGAGGG - Intronic
1032480409 7:132241594-132241616 TTGAAGGAGGACTGGAAAGAAGG - Intronic
1032527309 7:132588623-132588645 TTGAGGAAGGAAGGAAGGGAAGG + Intronic
1032654013 7:133907850-133907872 AGAAAGAAGGAGGGGAAGGAGGG + Intronic
1032823649 7:135548392-135548414 TTGGAGATAGATGGTAAGGATGG + Intergenic
1032824257 7:135553863-135553885 GTGAATAAGGAAGGGAAGGAAGG + Intergenic
1033165209 7:139034202-139034224 CAGAAGAGGGATGGGAAGAAGGG - Intronic
1033301784 7:140192621-140192643 ATGAAGAAGGAAGAGAAGAAAGG + Intergenic
1033332767 7:140429868-140429890 GTGAAGGAGGAGGGGAAAGAGGG - Intergenic
1033433232 7:141308094-141308116 ATGAAGAAGCCGGGGAAGGAGGG + Intronic
1033776319 7:144615403-144615425 TTGAAAAAAGATGGGACGAATGG + Intronic
1033786448 7:144737181-144737203 GGGAAGAAGGAAGGAAAGGAGGG + Intronic
1034391921 7:150793760-150793782 TTGAAGACAGATGGGAGGGGTGG - Intronic
1034451602 7:151139941-151139963 TTGGAGAAGTGTGGGAAGAAGGG - Intronic
1034869149 7:154668067-154668089 ATGAGGCAGGAAGGGAAGGAAGG - Intronic
1034964554 7:155383116-155383138 GTGAAGCAGGAAGGGAGGGAGGG + Intronic
1035260700 7:157659586-157659608 CTGAAGATGTATGGGAAAGAAGG - Intronic
1035541933 8:446902-446924 TGGAAGGAGAATTGGAAGGAAGG + Intronic
1035636968 8:1154998-1155020 CAGAAGCAGGATGGGAGGGAGGG - Intergenic
1035673643 8:1439270-1439292 TGGAAGAGGGAAGGGAAGGAGGG + Intergenic
1035971907 8:4258393-4258415 TGGAAGGAGGGAGGGAAGGAGGG + Intronic
1035971950 8:4258509-4258531 TGGAAGAATGAAGGGAGGGAGGG + Intronic
1036085004 8:5604054-5604076 TTGCAGAGGGATGGGGAGGGCGG - Intergenic
1036126594 8:6068598-6068620 AGGAAGGAGGATGGGAAAGAAGG - Intergenic
1036138952 8:6188731-6188753 TTGAGGCAGGAGGGGCAGGAAGG - Intergenic
1036754871 8:11465432-11465454 TTGAAGACTGATGGGGAGGATGG + Intronic
1036962299 8:13258219-13258241 CTAAAGAAGAATGTGAAGGAGGG - Intronic
1036978963 8:13446975-13446997 CGGAAGAAGGAAGGGAAGAAGGG + Intronic
1037246140 8:16837161-16837183 TTAAAGAAGAAAGGGACGGAGGG + Intergenic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1037432849 8:18831909-18831931 TAGAAAAAGTATGGGAAGAAAGG + Intronic
1037548911 8:19950853-19950875 GGGAAGGAGGAAGGGAAGGAGGG + Intronic
1037598404 8:20373623-20373645 GAGAAGAAGGAAGGGAAGGAAGG + Intergenic
1037617652 8:20534005-20534027 GTGAAGAAGGAATTGAAGGATGG + Intergenic
1038137295 8:24801570-24801592 CAAAAGAAGGAGGGGAAGGAAGG + Intergenic
1038219190 8:25591659-25591681 GGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1038271988 8:26082692-26082714 TGGAAGCAGGAGGGGAGGGACGG - Intergenic
1038313123 8:26461151-26461173 GAGAAGAAGGAGGGGAATGAAGG + Intronic
1038340325 8:26680519-26680541 AGGAAGAAGGAAGGGAGGGAGGG - Intergenic
1038428880 8:27484059-27484081 TTGCAGGAGGATGAGAAGGGGGG + Intergenic
1038544360 8:28413666-28413688 GGGAAGAAGGAAGGGAGGGAAGG - Intronic
1038754035 8:30324247-30324269 AGGAAGAAGGAAGGGAAGGAAGG + Intergenic
1038884942 8:31652930-31652952 GAGAGGAAGGAAGGGAAGGAGGG - Intronic
1038922432 8:32099565-32099587 CTTAAGAAGAATAGGAAGGATGG + Intronic
1038951184 8:32416309-32416331 TTAAGGAAGGAAGGGAGGGAGGG - Intronic
1039314494 8:36356499-36356521 GGGAAGGAGGAAGGGAAGGAAGG + Intergenic
1039455906 8:37706396-37706418 AGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1039614799 8:38946799-38946821 AGGAAGAAGGGTAGGAAGGATGG + Intronic
1039808839 8:41026787-41026809 GGAAAGAAGGAAGGGAAGGAGGG + Intergenic
1040026311 8:42785769-42785791 AAGAAGAAGGAAGGAAAGGAAGG + Intronic
1040777010 8:51057499-51057521 TTGAAGAACACTAGGAAGGAAGG + Intergenic
1040956712 8:52987522-52987544 TGAAAGGAGGAAGGGAAGGAAGG - Intergenic
1041084619 8:54245223-54245245 GAGAATCAGGATGGGAAGGAGGG + Intergenic
1041135879 8:54758440-54758462 TTGAAGGAGGGAGGGAAGGAGGG + Intergenic
1041607954 8:59806784-59806806 TTGAATAAGGGTGATAAGGATGG - Intergenic
1042230014 8:66545679-66545701 TGGAGGAAGGAGGGGAGGGAGGG + Intergenic
1042350898 8:67776505-67776527 TTGAAGAATGTTGGGGAGGTGGG + Intergenic
1042426830 8:68659049-68659071 TTGAGGAAGGAAGGGAGGGAGGG - Intronic
1042579289 8:70258625-70258647 TTGTAGAGGGATTGGAAAGAAGG - Intronic
1042781234 8:72493501-72493523 TTGAAAAATGGTGAGAAGGATGG - Intergenic
1042788168 8:72572831-72572853 TTGAAAATGCATGGGACGGAGGG + Intronic
1042931418 8:74017151-74017173 TTGAAAAAGGATTGGATGAATGG + Intronic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043266658 8:78274589-78274611 TGGAAGATGAATGGGAAGCAAGG - Intergenic
1043417265 8:80063966-80063988 GGGAAGAAGGAGGGGAGGGAGGG + Intronic
1043834113 8:85026956-85026978 AGGAAGGAGGAAGGGAAGGAAGG + Intergenic
1043877485 8:85502158-85502180 TGAAAGGAGGAAGGGAAGGAGGG - Intergenic
1043909838 8:85851252-85851274 AGAAAGAAGGAGGGGAAGGAAGG - Intergenic
1044253201 8:90028695-90028717 GGGAGGAAGGAAGGGAAGGAGGG - Intronic
1044512128 8:93094396-93094418 TGGAAGAAAGAAAGGAAGGATGG + Intergenic
1044622478 8:94203828-94203850 GGGAAGAAGGAAGGAAAGGAGGG + Intronic
1044867374 8:96585517-96585539 TTGAAGAGAAATGAGAAGGATGG + Intronic
1045322556 8:101092801-101092823 AGGAAGAAGGGAGGGAAGGAAGG - Intergenic
1045364325 8:101461793-101461815 ATGAAGAAGGAGGGAAACGAGGG - Intergenic
1045366890 8:101484821-101484843 TGGAAGAAGGAAGGGAGGAAGGG - Intergenic
1045412090 8:101929555-101929577 GGGAGGAAGGAAGGGAAGGAGGG + Intronic
1046138606 8:110061897-110061919 CTGAAGAAGGGAGGGAATGAGGG + Intergenic
1046905349 8:119566392-119566414 TTGAAGCAGTATGAGAAGCATGG - Intronic
1046916046 8:119679511-119679533 TTGATGAAGGCTGGGTAGGGTGG + Intergenic
1046952948 8:120035374-120035396 TTTGAGTGGGATGGGAAGGAGGG - Intronic
1046978121 8:120306083-120306105 TTCAGGAAGGATGGGAAAGATGG - Intronic
1047130127 8:122009420-122009442 TGAAAGAAGGAAGGTAAGGAGGG - Intergenic
1047481239 8:125285425-125285447 TAAAAGAAGGAAGGGAGGGAGGG - Intronic
1047730706 8:127725821-127725843 TTGAAGAAGGAAGGGAAGAATGG - Intergenic
1047839497 8:128735197-128735219 TTGAAGAAAGAAGGGCAGGAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048165610 8:132059080-132059102 TTGATGAAGGAAGAAAAGGAGGG - Intronic
1048174400 8:132138882-132138904 TGGCACAAAGATGGGAAGGATGG - Intronic
1048184814 8:132229974-132229996 TTTCAGAAGGAAGGGCAGGATGG + Intronic
1048272491 8:133040664-133040686 TGAAAGAAGGAAGGAAAGGAGGG + Intronic
1048571237 8:135658763-135658785 TTCAAGAAGAATGGGAGGAAAGG + Intergenic
1048690351 8:136955852-136955874 AGGAAGAAGGAAGGGAGGGAAGG - Intergenic
1048722758 8:137345315-137345337 TTGCCTAAGGATGGGAGGGAAGG - Intergenic
1048889632 8:138936053-138936075 CTGAGGAAGGATGTGGAGGAGGG + Intergenic
1049890553 9:66175-66197 TGGAAGAAAGAAGGGAGGGAGGG - Intergenic
1050131688 9:2419457-2419479 AGGAAAAAGGATGGGAAAGATGG + Intergenic
1050293221 9:4178432-4178454 TAGGAGAAGGAGGGGAAGGGAGG + Intronic
1050356838 9:4792106-4792128 TTGGAGGAGGACGGGAAAGAGGG + Intergenic
1050723373 9:8617238-8617260 GAGAAGAAAGATGGGAAAGAAGG + Intronic
1050942177 9:11473203-11473225 TAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1051014908 9:12462995-12463017 TGGAAGAAGGAAAGGAAGGATGG - Intergenic
1051014913 9:12463019-12463041 TGGAAGAAGGAGGGAAAGGAAGG - Intergenic
1051645886 9:19268001-19268023 ATAAAGGAAGATGGGAAGGAAGG - Intronic
1051662222 9:19436211-19436233 TTCAAGAAGGAAGGGCAGGCTGG - Intronic
1051681396 9:19611384-19611406 GAGAGGAAGGAGGGGAAGGAGGG + Intronic
1051712611 9:19947386-19947408 AAGAAGAAAGAAGGGAAGGAAGG + Intergenic
1051859429 9:21607288-21607310 AGGAAGGAGGAAGGGAAGGAAGG + Intergenic
1052029371 9:23610968-23610990 TTGAAGAATGAAAGGAAGGAAGG + Intergenic
1052648299 9:31267664-31267686 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
1053279045 9:36805622-36805644 CTGTAGAAGGATGGGAAGCAGGG + Intergenic
1053596245 9:39564546-39564568 TTGAAGAAGGAAGGAGGGGAAGG + Intergenic
1053732019 9:41067358-41067380 TGGAAGAAAGAAGGGAGGGAGGG - Intergenic
1053820931 9:41966190-41966212 ATTAAGAAGGAAGGGGAGGAGGG - Intronic
1054453963 9:65420212-65420234 GGGAAGAAGGAAGGGAGGGATGG + Intergenic
1054454106 9:65420632-65420654 GGGAAGAAGGGAGGGAAGGAGGG + Intergenic
1054570010 9:66800471-66800493 TTGAAGAAGGAAGGAGGGGAAGG - Intergenic
1054935825 9:70686733-70686755 GAGAAGGAGGAAGGGAAGGAAGG - Intronic
1055356989 9:75447927-75447949 AGGAGGGAGGATGGGAAGGAGGG - Intergenic
1055447296 9:76395605-76395627 AAGAAGAAGGAAGGGAGGGAAGG + Intergenic
1055557877 9:77493754-77493776 TTGTAAACGGATGGGATGGAAGG + Intronic
1055595053 9:77857532-77857554 GGGAAGAAGGAAGGGAGGGAGGG + Intronic
1055662361 9:78517767-78517789 TTGAAGGCAGAGGGGAAGGAAGG + Intergenic
1055699963 9:78933281-78933303 TTGCATATGGATGGGAAGCAAGG + Intergenic
1055930585 9:81555926-81555948 TAGAAGGAGGAGAGGAAGGAGGG - Intergenic
1055958231 9:81794299-81794321 GTGAAGAAGGCTGGGGAGGTGGG - Intergenic
1055988339 9:82077585-82077607 TAGAACAAGGTTGGAAAGGAAGG + Intergenic
1056325967 9:85479321-85479343 GAGAGGAAGGAAGGGAAGGAGGG - Intergenic
1056491139 9:87108244-87108266 TAGAAGAAGAATTGGAAGTATGG - Intergenic
1056510002 9:87295591-87295613 TTGAAGATTGATGCTAAGGAAGG - Intergenic
1056523157 9:87418753-87418775 ATGAAGGAGGGAGGGAAGGAAGG - Intergenic
1057202900 9:93152370-93152392 TTGAGGAAGGCTGGGAAATACGG + Intergenic
1057327044 9:94074929-94074951 TTGATGATGGATGAGAACGAAGG + Intronic
1057718834 9:97516584-97516606 TTGAGTGAGGATAGGAAGGAGGG + Intronic
1058027382 9:100156577-100156599 ATCAATAAGGATGGGAAGGAGGG - Intronic
1058149511 9:101448924-101448946 AGGAAGAAAGACGGGAAGGAAGG + Intergenic
1058297195 9:103324036-103324058 GAAAAGAAGGAAGGGAAGGAAGG - Intergenic
1058318572 9:103600323-103600345 TTGCAGAAGGAAGGGAAGAAGGG - Intergenic
1058369260 9:104246031-104246053 AGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1058388169 9:104462901-104462923 TTGAATAAAGATGTGACGGATGG - Intergenic
1058663675 9:107289184-107289206 TTGAAAAAGGAAGGGAAGGAAGG - Intronic
1058682046 9:107448671-107448693 TTTAGAAAGGAAGGGAAGGAGGG + Intergenic
1059058892 9:111014440-111014462 AGAGAGAAGGATGGGAAGGATGG - Intronic
1059257924 9:112947741-112947763 TTGTAGAAGGTAGGGAAGCAGGG + Intergenic
1059678842 9:116566856-116566878 GTGAAGGAGAGTGGGAAGGAAGG - Intronic
1059780104 9:117517072-117517094 TTGGAGAAGGAAGGAATGGAGGG + Intergenic
1059877580 9:118652648-118652670 AAGAAGAAGGGAGGGAAGGAGGG + Intergenic
1059970248 9:119659939-119659961 TTGAAGAATGATGAGAATGTTGG + Intergenic
1060135418 9:121148759-121148781 GGGCAGCAGGATGGGAAGGAAGG + Exonic
1060273619 9:122165848-122165870 GGAAAGAAGGAAGGGAAGGAAGG + Intronic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060753845 9:126194579-126194601 ATGAAGAAGGAGGGAAGGGAGGG - Intergenic
1061400380 9:130365172-130365194 TTGAAGAATGAACGGAAGGAGGG - Intronic
1061432540 9:130540391-130540413 AGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1061560080 9:131396291-131396313 AAAAAGAAGGAAGGGAAGGAAGG - Intronic
1061567805 9:131455307-131455329 TTGATGATGGCTGTGAAGGAGGG + Intronic
1061632465 9:131881774-131881796 AAGAAGAAGGAAGGGAGGGAGGG - Intronic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1061963303 9:133998916-133998938 TGGAAGAATGAATGGAAGGATGG - Intergenic
1062060736 9:134493959-134493981 GGGAAGCAGGATGGGAAGCAGGG + Intergenic
1062276223 9:135732803-135732825 AGGAAGAAGGAAAGGAAGGAAGG - Intronic
1062649588 9:137568705-137568727 TGGAAGCAGGAGGGGAAAGACGG + Intronic
1203653874 Un_KI270752v1:5007-5029 TTAAGGAAGGAAGGGAGGGAGGG - Intergenic
1185660006 X:1720016-1720038 AGGAAGAAGGGAGGGAAGGAGGG - Intergenic
1185766900 X:2732913-2732935 GGGAAGGAGGAAGGGAAGGAAGG - Intronic
1185772194 X:2773294-2773316 ATGAAGGAGGAAGGGAAGAAAGG + Intronic
1185915007 X:4025702-4025724 GGGAAGAAGGAAAGGAAGGAGGG - Intergenic
1186020066 X:5245131-5245153 TAAAAGAAGGAAGGGAAAGAGGG - Intergenic
1186064106 X:5742956-5742978 GAGGAGAAGGAGGGGAAGGAGGG + Intergenic
1186145659 X:6621712-6621734 AAGAAGAAGGGAGGGAAGGAAGG + Intergenic
1186206338 X:7204725-7204747 AGGAAGAAAGAAGGGAAGGAAGG - Intergenic
1186264559 X:7818532-7818554 TGCAAGAAGGAGGAGAAGGAGGG + Intergenic
1186478689 X:9879056-9879078 GGGAGGGAGGATGGGAAGGAAGG + Intronic
1186614219 X:11170016-11170038 TTGATGAATGAAGGGATGGATGG - Intronic
1186779639 X:12899810-12899832 GTGAAGAGGGAAGGGGAGGAAGG + Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187560327 X:20396842-20396864 TTGAAGAATTATGGAAAGCAGGG + Intergenic
1187615942 X:20993016-20993038 TTGCAGAAGCTGGGGAAGGAGGG + Intergenic
1187970661 X:24654783-24654805 ATGAAGAAGGAAGGGAGGAAGGG + Intronic
1188232659 X:27684262-27684284 GGGAAGCAGTATGGGAAGGAGGG + Intronic
1188648221 X:32595491-32595513 TTAAATAAGGCTGGGAAGCAGGG - Intronic
1188915714 X:35907751-35907773 TTAAAGAAAGACAGGAAGGAAGG - Intergenic
1189304934 X:39979726-39979748 TGGAAGAGGGATGGAAAGGGAGG + Intergenic
1189701022 X:43716360-43716382 TTGAGGAAGGAGGGGAATGATGG + Intronic
1189865593 X:45323811-45323833 TTGTAGAAGAGTGGGAAGGGTGG - Intergenic
1190047518 X:47124617-47124639 AAGAAGAAGGAAGGAAAGGAAGG + Intergenic
1190110931 X:47588446-47588468 GTGAAGTAGCAGGGGAAGGATGG + Intronic
1190203140 X:48381312-48381334 GGGAAGAAGGAAGGGAAGAAAGG - Intergenic
1190207398 X:48414097-48414119 GGGAAGAAGGAAGGGAAGAAAGG + Intergenic
1190275520 X:48896860-48896882 TGCAAGCAGGAAGGGAAGGACGG + Intronic
1190410129 X:50128989-50129011 AAGAAGAAGGAAGGGAGGGAGGG - Intergenic
1190953143 X:55165538-55165560 AGGAAGAAGGAAGGGAGGGAGGG - Intronic
1191053527 X:56219653-56219675 TTGAAGTAGGGGGGCAAGGATGG - Intergenic
1191707088 X:64104858-64104880 GGAAAGAAGGAAGGGAAGGAGGG + Intergenic
1191869730 X:65735878-65735900 TAGAAGAGGGATGGGGAGAAGGG + Intronic
1192082455 X:68061344-68061366 TTGCAGGAGGGAGGGAAGGAGGG + Intronic
1192183659 X:68931464-68931486 CTGACCAAGGATGGGAAGTAGGG - Intergenic
1192343296 X:70281420-70281442 AGGATGAGGGATGGGAAGGAGGG - Intronic
1192586155 X:72319648-72319670 TAGAATAAGGGTGGGAATGAGGG - Intergenic
1193269967 X:79517000-79517022 GGGAAGAAGGCAGGGAAGGAGGG + Intergenic
1193658811 X:84231658-84231680 GTGGGGAAGGATAGGAAGGAAGG + Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1194654688 X:96558329-96558351 AAGAAGAAGGAAGGGAAGAAGGG + Intergenic
1194980200 X:100432715-100432737 CTGAATAAAGATGGGAATGAGGG - Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195511437 X:105720358-105720380 TTGGAGAAGGGCGGGAGGGAGGG - Intronic
1195804092 X:108743156-108743178 AGGAAGAAGGAAGGGAGGGAGGG + Intergenic
1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG + Intronic
1196292127 X:113955135-113955157 TTGGATAAGGAAGGCAAGGAAGG - Intergenic
1196522916 X:116695229-116695251 GTGAATAAGGATGGGAATGGGGG - Intergenic
1196793610 X:119485542-119485564 TTGTGGAAGGAAGGGAGGGAGGG + Intergenic
1197478115 X:126948035-126948057 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1197816594 X:130504646-130504668 GTAAGGAAGGAAGGGAAGGAAGG - Intergenic
1197816616 X:130504725-130504747 GTAAGGAAGGAAGGGAAGGAAGG - Intergenic
1197816638 X:130504804-130504826 GTAAGGAAGGAAGGGAAGGAAGG - Intergenic
1197816659 X:130504878-130504900 GTAAAGAAGGAAGGAAAGGAAGG - Intergenic
1197976864 X:132175118-132175140 TTCAAGTAGGAGGGGAAGAATGG + Intergenic
1198160563 X:134003716-134003738 GGGAAGAAGGAAGGAAAGGAAGG + Intergenic
1198347118 X:135769460-135769482 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198347124 X:135769496-135769518 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198349024 X:135786722-135786744 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198349030 X:135786758-135786780 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198350930 X:135803994-135804016 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198350936 X:135804030-135804052 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198352836 X:135821259-135821281 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198352842 X:135821295-135821317 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198354745 X:135838515-135838537 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198354751 X:135838551-135838573 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198356656 X:135855797-135855819 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198356662 X:135855833-135855855 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198358569 X:135873077-135873099 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198358575 X:135873113-135873135 TGGAAGAAAGAAGGGAAGAAAGG + Intergenic
1198723670 X:139653219-139653241 TGGAAGAAGGGTGAGAATGAGGG + Intronic
1198962301 X:142195522-142195544 TTGAGCAGGGATGGGGAGGATGG + Intergenic
1199046560 X:143181195-143181217 ATCAGGAAGGAAGGGAAGGAAGG + Intergenic
1199312769 X:146340924-146340946 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1199342514 X:146698146-146698168 TTGAAGAAAGGAAGGAAGGATGG + Intergenic
1199342526 X:146698270-146698292 TTGAAGAAAGGAAGGAAGGAAGG + Intergenic
1199464031 X:148116063-148116085 CTGAAGAAAGAAAGGAAGGAAGG + Intergenic
1199783161 X:151081850-151081872 TGGAAGACAGGTGGGAAGGAAGG + Intergenic
1199976234 X:152896505-152896527 TTGCAGAAGGAAGTGATGGATGG - Intergenic
1200559691 Y:4686203-4686225 ATGAAGGAGGGAGGGAAGGAAGG + Intergenic
1201146434 Y:11067544-11067566 GTGAGGAAGGAAGGGAGGGAAGG + Intergenic
1201558695 Y:15292077-15292099 GAAAAGAAGGAAGGGAAGGAAGG + Intergenic
1201741138 Y:17325568-17325590 GGGAGGAAGGAAGGGAAGGAAGG + Intergenic