ID: 1162176165

View in Genome Browser
Species Human (GRCh38)
Location 19:8832138-8832160
Sequence CCCGTGGCTGGCGGTGTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162176150_1162176165 23 Left 1162176150 19:8832092-8832114 CCGAGGCCTCATGAACCGAAACA 0: 1
1: 0
2: 2
3: 3
4: 62
Right 1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 136
1162176160_1162176165 -6 Left 1162176160 19:8832121-8832143 CCTGGAGGGACGCAGGGCCCGTG 0: 1
1: 0
2: 0
3: 23
4: 207
Right 1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 136
1162176149_1162176165 24 Left 1162176149 19:8832091-8832113 CCCGAGGCCTCATGAACCGAAAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 136
1162176155_1162176165 8 Left 1162176155 19:8832107-8832129 CCGAAACACGGCTCCCTGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 136
1162176159_1162176165 -5 Left 1162176159 19:8832120-8832142 CCCTGGAGGGACGCAGGGCCCGT 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 136
1162176152_1162176165 17 Left 1162176152 19:8832098-8832120 CCTCATGAACCGAAACACGGCTC 0: 1
1: 0
2: 5
3: 9
4: 39
Right 1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162176165 Original CRISPR CCCGTGGCTGGCGGTGTCCG CGG Intronic
900105257 1:978369-978391 CCCGGGGCAGGCGGTTCCCGGGG - Intronic
900254731 1:1692276-1692298 CCTATGGCTGGCGCTGTGCGCGG - Intronic
900263483 1:1745551-1745573 CCTATGGCTGGCGCTGTGCGCGG - Intronic
903055537 1:20633654-20633676 CCGGCGGCGGGCTGTGTCCGCGG + Exonic
903235357 1:21946980-21947002 CCCGTGGCTGGGAGTGGCCGAGG - Intergenic
904622130 1:31782027-31782049 CCTGGGGCTGGCAGTGTCAGAGG - Intergenic
913485996 1:119333321-119333343 CCCGTGGCTGTCAGTGCACGGGG - Intergenic
915902369 1:159855952-159855974 TCCGGGGCTGGCGGCGCCCGCGG - Exonic
918870554 1:189968500-189968522 ACCTTGGCTGGCTGTGTCAGAGG - Intergenic
919892095 1:201982915-201982937 CCCGTGCCTGGAGGTGACGGCGG + Exonic
922809120 1:228406264-228406286 CCAGTGGCTCGCGGTGCGCGGGG + Exonic
924816383 1:247445487-247445509 TCCGTGCCTGGCGGTTTCTGAGG + Intronic
1064008506 10:11716333-11716355 GCCATGGCTGGCGGTGGCCAAGG + Intergenic
1068567174 10:58589019-58589041 TCCTTGGCTGCCGGTGTCCTTGG - Intronic
1070147510 10:73785760-73785782 GCCGGGGCTGGGGGTGGCCGGGG - Exonic
1072591113 10:96829582-96829604 CACATGGCAGGCGGTGTCCCAGG - Intergenic
1073288546 10:102402346-102402368 CCTGAGGCTGGGGGTGCCCGTGG - Exonic
1074818445 10:117162545-117162567 CCCCGGGCTGGGGGTGTCTGAGG + Intergenic
1074855068 10:117467331-117467353 CCAGAGGCTGCCTGTGTCCGTGG + Intergenic
1075463024 10:122631346-122631368 CCAGTGGCTGATGGTGTCTGTGG + Intronic
1075711842 10:124534763-124534785 CCCCAGGCTGGCGCTGTCGGTGG + Intronic
1076762577 10:132612667-132612689 CCCTTGCCTGGCCGTGTGCGTGG + Intronic
1076781168 10:132725413-132725435 CCCGAGGGTGGAGGTGTCAGCGG + Intronic
1077285144 11:1762264-1762286 ACCCTGGCTGGCGGTGTGCTGGG - Intronic
1080406891 11:31987555-31987577 CCCGGGGCTGGCGCTGTCCGCGG - Intronic
1083961217 11:66016037-66016059 CCCATGGCTGGGGGTGACAGTGG - Intergenic
1084153546 11:67302174-67302196 CCGGGGGCTGGGGGTGTCCTGGG - Exonic
1084702767 11:70798367-70798389 CCCGTGGTCGGTGTTGTCCGTGG - Intronic
1085312627 11:75525458-75525480 CCAGAGGCTGGGGGGGTCCGGGG + Exonic
1089397356 11:118145185-118145207 CCTGTCGCTGGAGGTGTCTGTGG - Exonic
1091024066 11:132126494-132126516 ACCATGGCTGGCAGTGTGCGGGG + Intronic
1096675040 12:53221692-53221714 GCCGCTGCTGGCGCTGTCCGGGG - Intronic
1096788480 12:54031136-54031158 CCTGTGGCAGCCGGTGTCCTCGG + Intronic
1104748377 12:131223653-131223675 ACCAGGGCTGGCGGTGGCCGAGG - Intergenic
1113664382 13:112131295-112131317 CCCGTGGCTGGGGGACCCCGTGG - Intergenic
1113878202 13:113607749-113607771 CCAGTGGGTGGCGGTGACGGGGG + Intronic
1122771796 14:104100988-104101010 CCCGGTGCTGGCGGAGTCCCTGG - Intronic
1123995313 15:25714011-25714033 GCCGTTGCTGGCGATGGCCGAGG + Exonic
1126161422 15:45617211-45617233 CCTGTGGCTGGAGGTGTGTGAGG - Intronic
1127474433 15:59319612-59319634 CCCGTGCCTGGCTGTCTCTGGGG - Intronic
1132483884 16:180480-180502 CGCGGGGATGGCGCTGTCCGCGG + Exonic
1132607700 16:800412-800434 CCCGTGGCTGGGGGCGTCCACGG - Intronic
1132730365 16:1357994-1358016 CCCGTGGCTGACAGTCTCGGTGG + Intronic
1133768138 16:8851900-8851922 CCCGGGGCTGGCAGAGTCCTAGG - Intergenic
1134956612 16:18385052-18385074 GCCGTGGCTGGCGCTGCCTGTGG - Intergenic
1136290208 16:29267217-29267239 CCCGTGGCTGCAGGTGACAGTGG - Intergenic
1141468541 16:84222834-84222856 CGTGTCGCTGGCGGTGTCTGAGG - Exonic
1142096092 16:88240738-88240760 CCCGTGGCTGCAGGTGACAGTGG - Intergenic
1142181795 16:88674774-88674796 GCAGTGGCTGGGGGTGTCCTGGG + Intergenic
1142483040 17:230097-230119 CCCGTGCCTGGGGCTGTCCTCGG - Intronic
1143150746 17:4806796-4806818 CCCGCGGCTGGAGGGGCCCGGGG + Intergenic
1143542858 17:7579957-7579979 TCCGTGGCTGGTGGTGCCTGTGG - Exonic
1143591492 17:7887983-7888005 CCCCTGGCTGGTGGTGGCCGAGG + Intronic
1145970119 17:28951309-28951331 CCCGGGGCTGGGGGTATCGGAGG + Exonic
1150294100 17:63998691-63998713 CCCAGGGCTGGGGGTGTGCGCGG - Exonic
1154025902 18:10706746-10706768 TCCGTGGCTGGATGTGTCTGAGG - Intronic
1160543586 18:79638507-79638529 CCCGGGGCTGGCCGTGCCCAGGG + Intergenic
1160690900 19:460435-460457 CACCTGGCTCGCGGGGTCCGGGG + Intronic
1160799263 19:960264-960286 CCCGTGGCTGGAGGCATCCAAGG + Intronic
1160979384 19:1809953-1809975 CCCCTGGCTGGGGGTGTGGGTGG - Intronic
1161013422 19:1970877-1970899 CCCATGGCAGGCGGTGCCCATGG + Intronic
1161264694 19:3358894-3358916 CCGGTGACTGCAGGTGTCCGGGG - Intergenic
1161396914 19:4049540-4049562 CTCGAGGCTGGCGGCGGCCGAGG + Intronic
1161577926 19:5065042-5065064 GCCGTGGCAGGCGGGGTCCCTGG + Intronic
1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG + Intronic
1163729273 19:18940335-18940357 CCCGTGGCCGGCGGCATCCGAGG - Intronic
1164394560 19:27851576-27851598 CCGCTGGCTTGCTGTGTCCGAGG + Intergenic
1165080571 19:33303717-33303739 CACGTGGCTGGGGGTCTCGGTGG - Intergenic
1165255569 19:34575690-34575712 CCCGCGGCTGGAGCTGTGCGGGG - Intergenic
1166322191 19:42025377-42025399 TCCATGGCTGGGGGTGTCTGAGG + Intronic
1166377168 19:42334099-42334121 CCGGTGGCTGGCACTGCCCGTGG - Exonic
1166873882 19:45885858-45885880 ACCGTGGCTCGCGCTGTCCCCGG - Exonic
1167269229 19:48498550-48498572 CCCGGGTCTGGAGGTGGCCGGGG + Exonic
1167829507 19:52008068-52008090 TCCGTGGCTGGGCGTGTTCGTGG - Intronic
1168722084 19:58559707-58559729 CACGGGGCTGGCAGTTTCCGTGG - Intergenic
925120496 2:1415017-1415039 CCCGGGGCCAGCGGTGTCCATGG - Intronic
927357070 2:22186441-22186463 CCCGGGGCCGGCGGGGCCCGCGG - Intergenic
932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG + Exonic
934031885 2:88055671-88055693 CCCCTGGCTGGCGGCGTTGGCGG - Exonic
937995987 2:127695537-127695559 CCCGCGGCCGGCGGGGTCCCGGG + Intergenic
945799601 2:214411103-214411125 CCAGTTGTTGGCGCTGTCCGTGG + Exonic
946340182 2:219061254-219061276 GCCGTGGGTTGCGGTCTCCGTGG - Intergenic
947215246 2:227744241-227744263 CCCCAGGATGTCGGTGTCCGTGG - Intergenic
948385383 2:237577624-237577646 CCCGTGGCTGGCAGTCTCCTGGG - Intronic
948599856 2:239101862-239101884 CCCGGGGCCGGGGGTGTCCAGGG - Intronic
948626910 2:239275121-239275143 CCCGTGGCTGACGGGGATCGGGG + Intronic
948699226 2:239750098-239750120 CCTGTGTCTGGGGGTGTCCTTGG - Intergenic
1169473789 20:5911711-5911733 AGCGAGGCTGGCGCTGTCCGCGG - Intronic
1171316540 20:24200446-24200468 CCCTTGGGTGCCGGTGTCCTAGG + Intergenic
1172117063 20:32579462-32579484 CCTGTGGCTGGGGGTGTCTGGGG - Intronic
1174353227 20:49982718-49982740 CCCGGTGCTGGGGCTGTCCGGGG - Intergenic
1175846860 20:62064321-62064343 CCCGTGGCTGGAGCAGGCCGAGG - Intronic
1176448456 21:6841433-6841455 CCAGTGGCTACCGGTGTCCAGGG + Intergenic
1176826626 21:13706455-13706477 CCAGTGGCTACCGGTGTCCAGGG + Intergenic
1180991829 22:19941721-19941743 GCCGTGGCGGGCGGGGTGCGGGG - Exonic
1181035497 22:20168065-20168087 CCAGTGGCTGGGGTTGTCCAAGG + Intergenic
1181531450 22:23519796-23519818 TCCGGGGCTGGCTGTGTCCCAGG - Intergenic
1183520809 22:38295160-38295182 CCCAAGGCAGGCGGTGTCTGTGG - Intronic
1183623081 22:38986160-38986182 GCCATGGCTGGGGGTGTCCCAGG + Intronic
1183633092 22:39045289-39045311 GCCATGGCTGGGGGTGTCCCAGG + Intronic
1183788495 22:40045495-40045517 CCCCTGGCTGGCGGTGGCAGAGG + Intronic
1184036373 22:41920099-41920121 CCCGGGGCCGGTGGTGGCCGGGG + Intergenic
1184091441 22:42295025-42295047 CCCATGGCTGGTGGTGTTCCAGG - Intronic
1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185343691 22:50302363-50302385 CCCGTGGCTGGAGCTGTGTGGGG + Intronic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
954325227 3:49859777-49859799 CCCGGGGGTGGCAGTGTCTGTGG + Exonic
961353213 3:126316823-126316845 CCCGTGGCTGGCACTGCCTGGGG + Intergenic
961551350 3:127672204-127672226 CGCGGGCCTGGCGCTGTCCGGGG + Intronic
961557519 3:127706808-127706830 CCCGTGGAAGGCTGTGTCCTGGG + Intronic
967924028 3:194632816-194632838 CCCAGGGCTCGCGGTGTCCTCGG + Intronic
968545511 4:1195718-1195740 CCTGGGGCTGGGGGTCTCCGGGG - Intronic
968952978 4:3704095-3704117 GCCGTGGCTGGCGGCTTCCTGGG + Intergenic
969100489 4:4764698-4764720 GCCGTGGCCGGCGGTGCCCTGGG + Intergenic
969703977 4:8782247-8782269 CCCGGGGCTGGGGGTGCCAGGGG - Intergenic
973619380 4:52712246-52712268 CCATTGGCTGTCGGTGTCCGGGG - Intergenic
984811377 4:183798306-183798328 CCGGTGGCGGGCGGTGCCTGAGG + Intergenic
986072123 5:4295847-4295869 GCCCCGGCTGGCGGTCTCCGTGG - Intergenic
1002257751 5:177971229-177971251 CGTCTGCCTGGCGGTGTCCGAGG - Intergenic
1004396123 6:15248128-15248150 CCCGTGGCTGGCGGCGGCTGCGG + Intronic
1007809452 6:44475885-44475907 CCCGTGGCCGGCCGTCTCTGGGG - Intergenic
1008520945 6:52362143-52362165 CCCGCGGGTGGCTGTGACCGCGG - Exonic
1011931792 6:92723601-92723623 CCCGGGGCTGGCGGCGACGGAGG - Intergenic
1018895826 6:168016426-168016448 CCGGTGGCTGGGGCGGTCCGTGG - Intronic
1018990823 6:168672020-168672042 CCTGTGGCTCGCGTTGCCCGCGG - Intronic
1019449031 7:1086953-1086975 GCCGGGGCTGGCGGTGCCTGAGG + Exonic
1019811926 7:3171150-3171172 CCCGTGGTTGGTGGAGCCCGTGG - Intronic
1019811931 7:3171166-3171188 CCCGTGGTTGGTGGAGCCCGTGG - Intronic
1024273646 7:47660237-47660259 CCCGTGGCTGTAGGTGTCATGGG + Exonic
1025085442 7:56019717-56019739 CCCATGGCTCGCCGTGTCCTAGG + Exonic
1027246240 7:76369512-76369534 CCTGTGGCTGGAGGTGTGCTAGG - Intergenic
1032344381 7:131106025-131106047 CGCGCGGCCGGCGGTGCCCGGGG - Intergenic
1033673039 7:143511427-143511449 CAGGGGACTGGCGGTGTCCGTGG - Intergenic
1034219281 7:149431704-149431726 CTCGGGCCTGGCGGTGTCCGAGG + Exonic
1034446293 7:151115732-151115754 TCCGGGGCTGGCGGGGTCTGGGG + Intronic
1035629808 8:1098644-1098666 GGCGTGGGTGGCGGCGTCCGTGG - Intergenic
1042022243 8:64380074-64380096 TCCCTGCCTGGCGCTGTCCGCGG + Intergenic
1049706785 8:144046794-144046816 CCCGGAGCTGGCGGCGTCTGAGG + Exonic
1052837918 9:33265198-33265220 CCCGGGGCTGGGGGTGGGCGGGG - Intronic
1055090912 9:72364568-72364590 GCCGCGGATGGCGGCGTCCGGGG - Exonic
1060508706 9:124216806-124216828 GCTGTGGGTGGGGGTGTCCGGGG + Intergenic
1061014855 9:127975724-127975746 CACGTGGCTGGTGGTGCCAGGGG - Intronic
1062230324 9:135478994-135479016 CCCGAGGCTGGCGGTGGCCCGGG - Intergenic
1062272140 9:135714459-135714481 CCGGTGGGTCGCGGTGGCCGCGG + Intronic
1062560430 9:137139267-137139289 CACGCGGCCGGCGCTGTCCGCGG - Intronic
1203520735 Un_GL000213v1:43085-43107 CCAGTGGCTACCGGTGTCCAGGG - Intergenic
1198682182 X:139194835-139194857 TCCGTGGCTGGCGGTGCGGGTGG - Intronic
1200216905 X:154371989-154372011 CCCGTGGCAGGGGGTCTGCGGGG - Intronic