ID: 1162179853

View in Genome Browser
Species Human (GRCh38)
Location 19:8860980-8861002
Sequence CAGGTACAAGGTGGGGTGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 319}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162179853_1162179863 7 Left 1162179853 19:8860980-8861002 CCAGCCACCCCACCTTGTACCTG 0: 1
1: 0
2: 2
3: 43
4: 319
Right 1162179863 19:8861010-8861032 GATGTCCACCAACTGGTAGGTGG 0: 1
1: 0
2: 0
3: 21
4: 169
1162179853_1162179861 0 Left 1162179853 19:8860980-8861002 CCAGCCACCCCACCTTGTACCTG 0: 1
1: 0
2: 2
3: 43
4: 319
Right 1162179861 19:8861003-8861025 TCACATGGATGTCCACCAACTGG 0: 1
1: 0
2: 0
3: 4
4: 124
1162179853_1162179867 28 Left 1162179853 19:8860980-8861002 CCAGCCACCCCACCTTGTACCTG 0: 1
1: 0
2: 2
3: 43
4: 319
Right 1162179867 19:8861031-8861053 GGAGCCCAGCCAATGGAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 222
1162179853_1162179862 4 Left 1162179853 19:8860980-8861002 CCAGCCACCCCACCTTGTACCTG 0: 1
1: 0
2: 2
3: 43
4: 319
Right 1162179862 19:8861007-8861029 ATGGATGTCCACCAACTGGTAGG 0: 1
1: 0
2: 0
3: 19
4: 68
1162179853_1162179866 21 Left 1162179853 19:8860980-8861002 CCAGCCACCCCACCTTGTACCTG 0: 1
1: 0
2: 2
3: 43
4: 319
Right 1162179866 19:8861024-8861046 GGTAGGTGGAGCCCAGCCAATGG 0: 1
1: 0
2: 1
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162179853 Original CRISPR CAGGTACAAGGTGGGGTGGC TGG (reversed) Exonic
900619610 1:3580737-3580759 CAGGGCCAGGGTGGGATGGCAGG + Intronic
901373286 1:8818086-8818108 CAGGTCCCGGGTGGGGTGGGGGG + Intergenic
901952190 1:12758099-12758121 AAGGAACAAGGTGGAGGGGCAGG - Intronic
902079186 1:13809500-13809522 CAGGAGCAGGGTGGAGTGGCAGG + Intronic
902442053 1:16437098-16437120 CAGGGCCAAGGTGGGGTGTAAGG - Intronic
902895798 1:19479266-19479288 GAGGGAGATGGTGGGGTGGCGGG - Intronic
902933125 1:19745277-19745299 CAGGTAAAAGGGTGGGTGGGTGG + Intronic
903056822 1:20641894-20641916 GAGATACATGGTGGGGTTGCGGG - Intronic
903608100 1:24589705-24589727 CAGGGACAGGGTGGTGTGGTAGG + Intronic
903686737 1:25137201-25137223 CAGGAAGAGGGTGGGGTGGGGGG - Intergenic
904403258 1:30270617-30270639 CAGGTAGGAGGTGGGCAGGCAGG - Intergenic
904462489 1:30688503-30688525 CAGGTACATGGTGTGGGGGTTGG - Intergenic
904586642 1:31584464-31584486 CAGGTATCAGGTGGTGGGGCGGG - Intronic
904969184 1:34405762-34405784 CTGGTAGAAGGTGGGGTAGGAGG - Intergenic
904999635 1:34658087-34658109 GAGGGACAATGTGGGGTGGATGG + Intergenic
906196112 1:43931787-43931809 CAGGCAGTAAGTGGGGTGGCCGG + Intergenic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
907310361 1:53535535-53535557 CAGGTAGAAGGTGGGAGGTCAGG - Intronic
907734349 1:57097311-57097333 CAGGTACCATCTGGGCTGGCAGG + Intronic
907743868 1:57193219-57193241 CAGGGACCGGGTGGGGTGGGTGG - Intronic
909191036 1:72552330-72552352 CAGGTACAAGGTGGCTCTGCTGG + Intergenic
912530697 1:110319204-110319226 CAGATTCAAGGTGGGGTGGGAGG - Intergenic
912800325 1:112715811-112715833 CTGGTACCGGGTGGGGTTGCGGG + Intergenic
912944527 1:114073995-114074017 CAGGAATGAGGTGGGGTGCCAGG + Intergenic
914004912 1:143724027-143724049 CAGGGACAAGGTGTAGGGGCAGG + Intergenic
914948560 1:152089038-152089060 CAGGTAGAACGTGGGGCAGCGGG + Exonic
915992683 1:160532435-160532457 CACTTCCTAGGTGGGGTGGCTGG - Intergenic
919520814 1:198584339-198584361 CACCTACCAGGTGGGGTGGCTGG + Intergenic
920349909 1:205331091-205331113 CAGGTCCAGGGTGTGCTGGCTGG + Intergenic
920631439 1:207656672-207656694 CAGGAGCAAGGTGGGGAGGACGG + Intronic
921713344 1:218394677-218394699 CATGTAATAGGTGGGATGGCCGG + Intronic
922238170 1:223736928-223736950 CAGCTACAAGGTGAGGTGGGAGG + Intronic
922326362 1:224532013-224532035 AAGGTAGACGGTGGGGTGGGAGG + Intronic
923514209 1:234680990-234681012 CAGGTAGAAGGTGAGGTTGGAGG + Intergenic
923545923 1:234923249-234923271 CAGGGAAAAGGTGGGGGGGTTGG - Intergenic
1063575906 10:7261869-7261891 CAGATTCAAAGTAGGGTGGCTGG + Intronic
1064239761 10:13615790-13615812 CAGGTAGGGGGTGGGGTGGGGGG + Intronic
1064973648 10:21090990-21091012 GAGGTTCTAGTTGGGGTGGCTGG - Intronic
1065920980 10:30392608-30392630 CAGGATCAGGGTGGGGAGGCAGG + Intergenic
1066512501 10:36117394-36117416 CAGGGACAGGGAGGGGTGGCTGG - Intergenic
1066657035 10:37705623-37705645 CAGGCCCAGGGTGGTGTGGCAGG + Intergenic
1067041580 10:42955863-42955885 CAGGCCCAGGGTGGTGTGGCAGG + Intergenic
1067727649 10:48782905-48782927 CAGGAGCAAGGTGGGTTGGAGGG + Intronic
1069961829 10:72083711-72083733 CAGTTAGAAGGTGGGGTGGAGGG + Intronic
1070060680 10:72980637-72980659 CAGGCACAAAGTTGGTTGGCTGG + Intergenic
1070166749 10:73904634-73904656 CTGGTTCAAGGTGGGCAGGCAGG + Intergenic
1071823652 10:89302826-89302848 CAGTTTGAAGGTGGGGTGGCCGG + Intronic
1072194705 10:93107225-93107247 CAGGGACAAGCTGGTGTTGCTGG - Intergenic
1073237749 10:102033006-102033028 CAGGTACAAGGCTGGGAGACTGG - Exonic
1073464090 10:103683835-103683857 AAGGTGGAAGGAGGGGTGGCTGG - Intronic
1075465136 10:122645337-122645359 CAGGTGTATGGTGGGGTGGGTGG + Intergenic
1075651782 10:124132172-124132194 AAGGTTCTAGGAGGGGTGGCAGG - Intergenic
1075748228 10:124743141-124743163 GGGGGACAAGGTGGGGGGGCGGG + Intronic
1075839997 10:125493618-125493640 CAGCTGCCAGGTGGGGTGGGTGG - Intergenic
1076219018 10:128718102-128718124 CAGGTTTTGGGTGGGGTGGCAGG + Intergenic
1076418240 10:130307764-130307786 AAGGTTCTAGGTGGGGTGGTGGG + Intergenic
1076712794 10:132347815-132347837 CAGGTGGCAGGTGGGGTGACGGG + Intronic
1077204349 11:1335373-1335395 CAGGTAGAAGGTGGGGGAGAGGG - Intergenic
1077376039 11:2205494-2205516 GAGGTAGAAGGTGGGCAGGCTGG - Intergenic
1078667907 11:13341295-13341317 CAACTACAAAGTGGGGTGGTGGG - Intronic
1079098532 11:17526691-17526713 CATCTTCAAGGAGGGGTGGCCGG - Intronic
1080069990 11:28070931-28070953 CAGCTACTTGGTGGGGTGGAGGG + Intronic
1080202512 11:29689344-29689366 AGGGTAAAAGGTGGGGTGGTTGG + Intergenic
1081825727 11:46049529-46049551 CAGGTAGAAGAGGGTGTGGCGGG + Intronic
1083457955 11:62791633-62791655 CTGTGACAACGTGGGGTGGCGGG - Intronic
1083659371 11:64245191-64245213 CAGGGTCAAGGTGAGGGGGCTGG - Exonic
1084464503 11:69314131-69314153 TGGGTACAAGGAGGGGTGGATGG - Intronic
1084646512 11:70461999-70462021 CAGGAACAAAATGGGGTGGGTGG - Intergenic
1084660059 11:70541454-70541476 CAGGTAGCAGGTGGGCTGGCAGG + Intronic
1085759952 11:79233301-79233323 CAGATGGAAGGTTGGGTGGCTGG + Intronic
1085841082 11:80012593-80012615 GAGGGAGAAGGTGGGGTGGGAGG + Intergenic
1087742538 11:101905339-101905361 TTGGTACAGGGTGGAGTGGCTGG - Intronic
1088190228 11:107220343-107220365 CAGATTCAAGGTGGGGTGGGGGG - Intergenic
1089212030 11:116810962-116810984 CAGGTGCAGCGTGGGCTGGCAGG - Intergenic
1089329245 11:117678276-117678298 AGGCTACAGGGTGGGGTGGCGGG + Intronic
1089634604 11:119804191-119804213 CAGGTGCAAGGAGAGGTGGAAGG + Intergenic
1089794243 11:120967448-120967470 TAGGTATAAAGTGGGCTGGCGGG + Intronic
1089977340 11:122743784-122743806 GAGGGGCAAGGTGGCGTGGCAGG + Intronic
1090187545 11:124748189-124748211 GCGGTACAGGGTGGAGTGGCTGG - Intronic
1090262706 11:125332946-125332968 TAGGTACAATGAGGGGTGGGTGG + Intronic
1091320746 11:134647600-134647622 CAGGTAGGAGGTGGGGAGCCAGG - Intergenic
1091807165 12:3365111-3365133 CAGGCGGAGGGTGGGGTGGCAGG - Intergenic
1091967960 12:4761538-4761560 CAGGTATGATGTGGGGTGGTAGG + Intronic
1092582702 12:9862987-9863009 CAGAGACAAAGTGGGGAGGCAGG + Intronic
1092877014 12:12857126-12857148 GAGGTTCAAGGTGGTGAGGCAGG - Intergenic
1092996204 12:13953316-13953338 CAGATACAAGGGGAGGGGGCTGG + Intronic
1094237939 12:28190316-28190338 CACGCTCAAGCTGGGGTGGCAGG + Intronic
1095820922 12:46477692-46477714 CAGGTAAGAGGTGGGGTGATTGG - Intergenic
1096096470 12:48938780-48938802 CAGGAAAAAGGAGGGGAGGCAGG + Exonic
1097110021 12:56651682-56651704 AAAGTACAAGTCGGGGTGGCTGG + Intergenic
1097186682 12:57199958-57199980 CAGGTAGAAGTTGGTGGGGCAGG - Exonic
1100667406 12:96769964-96769986 CAGGTGCAAGGTGGTATGGGAGG - Intronic
1100685852 12:96985573-96985595 TAGGTTCCAGGTGGGGTGCCCGG - Intergenic
1102520095 12:113472499-113472521 CAGGCCCAGGGTGGGGAGGCGGG + Intergenic
1103904990 12:124322559-124322581 CGGGCACCAGGTGGGGTGTCAGG + Intergenic
1104644137 12:130485104-130485126 CAGGTACAGGGTGGGAGGGAGGG + Intronic
1105805396 13:23949160-23949182 CACATCCCAGGTGGGGTGGCAGG + Intergenic
1107737568 13:43415927-43415949 CAGTTCCCAGATGGGGTGGCCGG + Intronic
1113750563 13:112773883-112773905 AAGGCACGAGGTGGGGTGGAGGG - Intronic
1113884779 13:113652730-113652752 AAGGTACAGGGTGGTGAGGCTGG + Intronic
1113910049 13:113837441-113837463 CAGATACAACGTGGGGAGGGAGG + Intronic
1114664448 14:24369630-24369652 CAGGTGCCAGGTGAGGGGGCTGG - Exonic
1115769591 14:36656045-36656067 CTGTGACAAGGTGCGGTGGCCGG + Intergenic
1119114534 14:72007260-72007282 CACGTACCATGTGGGGAGGCTGG - Intronic
1119422657 14:74516773-74516795 CAGGTGGGTGGTGGGGTGGCAGG + Intronic
1119826782 14:77663432-77663454 CAAGTACAAGGTGTAGTGGGAGG - Intergenic
1122390134 14:101374493-101374515 CAGGTAAAAGGAGGGCTGTCTGG - Intergenic
1122403515 14:101481797-101481819 CAGAGAGAAGGTGGGATGGCAGG + Intergenic
1123018046 14:105384825-105384847 CTGGTGCCAGGTGGGGTTGCAGG - Intronic
1123468079 15:20530766-20530788 CCAGTACACGGTGGGGAGGCTGG + Intergenic
1123650033 15:22470276-22470298 CCGGTACACGGTGGGGAGGCTGG - Intergenic
1123728395 15:23125975-23125997 CCGGTACACGGTGGGGAGGCTGG + Intergenic
1123740439 15:23279118-23279140 CCGGTACACGGTGGGGAGGCTGG - Intergenic
1123746559 15:23323440-23323462 CCGGTACACGGTGGGGAGGCTGG + Intergenic
1124278826 15:28346757-28346779 CCGGTACACGGTGGGGAGGCTGG + Intergenic
1124303873 15:28564851-28564873 CCGGTACACGGTGGGGAGGCTGG - Intergenic
1124501431 15:30230539-30230561 CAGGCACAAGGTGGCCTGGGAGG - Intergenic
1124742137 15:32308128-32308150 CAGGCACAAGGTGGCCTGGGAGG + Intergenic
1125031894 15:35082399-35082421 CACTTCCCAGGTGGGGTGGCTGG - Intergenic
1127148169 15:56047354-56047376 AAAGTACAAGGTGAAGTGGCAGG - Intergenic
1128339103 15:66808201-66808223 CAGGGACAGGGAGGGGAGGCGGG - Intergenic
1128390850 15:67181473-67181495 CAGGGGCAGGGTGGGGGGGCGGG - Intronic
1128559052 15:68652504-68652526 CAGGTGCCAGTTGGGGTAGCAGG - Intronic
1128605160 15:69031542-69031564 CAGGTACAGAGTGGGGTGCTGGG + Exonic
1129570839 15:76682268-76682290 CACGTACACTGTGGGGTGGGGGG - Intronic
1130402286 15:83568476-83568498 AAGTTACAAGGTGGAGTGACAGG - Intronic
1131105533 15:89731573-89731595 CAGGTACTAGGTAGAGAGGCAGG - Intronic
1131159961 15:90099250-90099272 CAGGCACCAGGTGGAGTGACAGG - Intronic
1131458908 15:92604779-92604801 CAGGCACAGGGTGTGGTGCCAGG + Intergenic
1132999189 16:2840667-2840689 CAGCTTCAGGGTGGGGTGGGAGG + Intergenic
1133171469 16:3984905-3984927 CAGGAACTAGGTGGGAGGGCAGG + Intronic
1134272858 16:12749065-12749087 CTGCTGAAAGGTGGGGTGGCTGG + Intronic
1134683920 16:16145708-16145730 CAGGGAGAAAGTGGGGTGGCTGG - Intergenic
1134717197 16:16363074-16363096 CAGGTGCGCGGTGGGGGGGCAGG - Intergenic
1134862778 16:17575504-17575526 CAGGTACAGGGTGGGGTAGGGGG - Intergenic
1134957554 16:18389085-18389107 CAGGTGCGCGGTGGGGGGGCAGG + Intergenic
1135910431 16:26555733-26555755 CAGCCTCAAGGTGGGGTGGAAGG - Intergenic
1137546756 16:49410168-49410190 CAGGAACACAGTGGGGTAGCTGG + Intergenic
1137643936 16:50058354-50058376 CAGGTACACGGTGGTGCCGCAGG + Intergenic
1137869791 16:51938957-51938979 AAGGTAGAAGGTGGAGTGGCCGG - Intergenic
1138722007 16:59092973-59092995 CAGGTGCAATGTGGGGAGACAGG - Intergenic
1139447354 16:67006028-67006050 CAGGTTAAAGGGGGGGGGGCTGG + Intronic
1139635866 16:68258037-68258059 CAGATACAGGGTGGGGTGATGGG + Intronic
1141442778 16:84040238-84040260 AAGGAACAACTTGGGGTGGCGGG + Intronic
1142623382 17:1178839-1178861 CAGGAGCAAGGTGCGGTGGTGGG + Intronic
1143111439 17:4555114-4555136 CAGGCCGAAGGTGGAGTGGCGGG - Exonic
1143116625 17:4584967-4584989 CAGCGAGAAGGTGGCGTGGCTGG - Exonic
1143120272 17:4602282-4602304 CAGGGACAATCTGGGGTGGAAGG + Intronic
1144673553 17:17146623-17146645 CAGGGTCAAGGTGGGCTGGCAGG - Intronic
1144779446 17:17800501-17800523 CAGGGACAGGATGGGGTGGTCGG - Intronic
1145110499 17:20157208-20157230 TAGGGCCAAGGTGGGGCGGCTGG - Intronic
1145787833 17:27605540-27605562 CAGGTACACGCTGGTCTGGCTGG - Exonic
1146441249 17:32897014-32897036 GAGGTACAAGGTGGCCTGCCAGG - Intergenic
1146795111 17:35775040-35775062 CAGGCAGAAGAGGGGGTGGCGGG + Intronic
1147387578 17:40091191-40091213 GAGGGTCAGGGTGGGGTGGCAGG - Intronic
1147759493 17:42788196-42788218 CTGGTACAAGTTGGGGTGCCAGG + Intronic
1147816003 17:43211517-43211539 CGGGTAGAAGGTGGAGCGGCAGG + Exonic
1148683336 17:49486960-49486982 CAGGTGGAGGGTGGGATGGCTGG - Intergenic
1148797936 17:50206135-50206157 CTGGGACCTGGTGGGGTGGCTGG - Intergenic
1149639260 17:58192567-58192589 CTGGTAGGAGGTGGGGTGGGGGG + Intergenic
1150101107 17:62424216-62424238 CAGGGACAATGTGGAGTGGTCGG + Exonic
1150737933 17:67756055-67756077 CAGTTCCAGAGTGGGGTGGCAGG - Intergenic
1152574689 17:81134843-81134865 GAGGGGCAAGGTGGGGTGACTGG - Intronic
1152595291 17:81234813-81234835 CAGGGGCAGCGTGGGGTGGCAGG - Intronic
1152831709 17:82501344-82501366 GAGGTAGAGGGTGGGGAGGCAGG - Intergenic
1155043920 18:22087522-22087544 CAGGGACAATTTGGGGTGGGGGG - Intergenic
1155191897 18:23437768-23437790 CACGAACAAGGTGAGGGGGCGGG - Exonic
1157434613 18:47657912-47657934 CAGGTAAGAGGTGGGGTTCCAGG - Intergenic
1158173751 18:54629898-54629920 GAGGTACAAGGTAGGATGGAGGG - Intergenic
1159428109 18:68315149-68315171 CAGGTAGAAGGTGGGGGTGGAGG + Intergenic
1160125633 18:76169206-76169228 CAAGGACAAGGTGGGGCCGCAGG + Intergenic
1160497239 18:79382830-79382852 CAGGAGCAGGGCGGGGTGGCCGG - Intergenic
1160873584 19:1287462-1287484 AGGGGACAAGGAGGGGTGGCGGG - Intronic
1160908024 19:1460855-1460877 CAGGTACAGGGCGGGGTGCTGGG + Exonic
1160918039 19:1507001-1507023 CAGGATCAAAGTGGGGAGGCTGG - Intronic
1161431195 19:4233361-4233383 CAGGTGGGAGGTGGGGTGGGGGG - Intronic
1162110250 19:8396189-8396211 CGGGTACCAGGTGGGGTTGTAGG + Intronic
1162179853 19:8860980-8861002 CAGGTACAAGGTGGGGTGGCTGG - Exonic
1162277231 19:9665510-9665532 CAGGGACAAAGAGGGGAGGCAGG + Intronic
1162502803 19:11063970-11063992 CAGGTTCAAGCTGGGCTGGGTGG - Intronic
1162567602 19:11453017-11453039 CAGGCCCAGGGTGGGGTGGATGG - Exonic
1163157860 19:15449215-15449237 CAGGGAGATGGTGGGGAGGCCGG + Intronic
1165694605 19:37891456-37891478 GAGATACTAGGTGGGCTGGCGGG - Intronic
1166878723 19:45914094-45914116 CAGGTCCAAGGGGGCGGGGCTGG + Exonic
1168273733 19:55265110-55265132 CAGGTACACGGGGAGGTGACGGG - Intronic
925341796 2:3142913-3142935 CTGCTCCCAGGTGGGGTGGCAGG + Intergenic
925411847 2:3644066-3644088 GAAGTACATGGTGGTGTGGCAGG - Exonic
926683119 2:15678947-15678969 CAGCTACAAGGGGAGGTGGCTGG - Intergenic
927157770 2:20231446-20231468 AAGGTACAATGTGGGGAGCCAGG + Intergenic
927749201 2:25651453-25651475 GAGGTAGAAGGTGAGGTGGAGGG + Intronic
928340046 2:30435122-30435144 GAGGTGCAAGGTTGGTTGGCAGG + Intergenic
929325870 2:40610055-40610077 CAGGTTGAAGTTGGAGTGGCTGG + Intronic
929757320 2:44778525-44778547 CAGGTGCAAGGGGAGGGGGCGGG + Intergenic
930095231 2:47561519-47561541 CATGCACAGGGTGGTGTGGCCGG + Intronic
931225378 2:60324808-60324830 AAGGCACAGGGTGGGGTGGAAGG - Intergenic
931383263 2:61773490-61773512 CAGGAACAAGAGGGAGTGGCAGG + Intergenic
932338505 2:70944414-70944436 CAGCTAGGAGGTGGGGTGGGAGG - Intronic
932845446 2:75130364-75130386 CAGCCACCAGATGGGGTGGCAGG + Intronic
933770595 2:85741702-85741724 AAGGGACTAGGTGAGGTGGCAGG - Intergenic
933869091 2:86549436-86549458 CAGTTCCCAGATGGGGTGGCCGG + Intronic
934715806 2:96542594-96542616 AAGGTCCAAGGTGGGGCAGCAGG - Intronic
937292497 2:120790178-120790200 TGGGTACCAGGTGGGGTGGTGGG + Intronic
937310357 2:120898816-120898838 CAGTTACCAGTTGGGGTAGCTGG + Intronic
937982654 2:127624406-127624428 CAGGTAGAAGGTGGGGGGGCAGG + Intronic
942333079 2:174849828-174849850 CAGCTAGTAGGTGGGGGGGCTGG + Intronic
943125776 2:183792360-183792382 CAGTTCCCAGATGGGGTGGCCGG + Intergenic
948287199 2:236795145-236795167 CAGTTCCAAGGTGAGGAGGCAGG - Intergenic
948766864 2:240226930-240226952 GAGGGGCAAGGTGGGCTGGCAGG - Intergenic
948882530 2:240867501-240867523 CAGGCCCCAGGTGGGGTGGGTGG + Intergenic
1170460286 20:16571425-16571447 CAGGTACATGGAGGGATGGCAGG - Intronic
1173796376 20:45863414-45863436 CAGGAACAGGGTGGGGGTGCTGG + Intronic
1174275681 20:49402250-49402272 GAGGTACAAGCTGGAGTGGCAGG - Intronic
1175898337 20:62350067-62350089 CAGGTGCAAGCAGGGGTGACTGG - Intronic
1176254302 20:64142989-64143011 CAGGAACAAGGAGAGGTAGCTGG - Intergenic
1176257528 20:64160001-64160023 CAGGCACAAGGTATGGTGGGAGG - Intronic
1179253867 21:39698297-39698319 CAGGGACGAGGTGGGGAGGAGGG + Intergenic
1179329912 21:40390025-40390047 AAGGGACAGGGTGGGGTGGTGGG - Intronic
1179577263 21:42315695-42315717 CAGGAGCCATGTGGGGTGGCAGG + Intergenic
1180802268 22:18637462-18637484 TGGGCACAAGGTGGGGTGGCCGG - Intergenic
1180853507 22:19033014-19033036 CGGGAACAAGGTGGGGTGGCCGG - Intergenic
1180956606 22:19744043-19744065 CAGGGCCAACGTGGGGTGCCTGG - Intergenic
1181219457 22:21357797-21357819 TGGGCACAAGGTGGGGTGGCCGG + Intergenic
1182794982 22:32985405-32985427 CAGGTGCAAGGAGTGATGGCTGG + Intronic
1183120878 22:35729043-35729065 AAGGCACCAGGTGGCGTGGCAGG - Intronic
1183719766 22:39555916-39555938 CAGGAACAAGGTAGCATGGCAGG - Intergenic
1184188066 22:42877773-42877795 CAGTTACTTGGTGGGGTGCCAGG - Intronic
949178241 3:1093223-1093245 CAGGTAAAAGCTGGGGTTGGGGG + Intronic
949230841 3:1748677-1748699 CAGGAAAGTGGTGGGGTGGCGGG + Intergenic
950118023 3:10463901-10463923 CAGGGACCAGGTGGGGTGTGGGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
952050918 3:29383679-29383701 CAGGTACTAAGTGAGGTGCCAGG - Intronic
952526093 3:34211924-34211946 TACGTAGAATGTGGGGTGGCAGG - Intergenic
953025784 3:39144124-39144146 CAAGTGCCAGGTGTGGTGGCTGG - Exonic
954390812 3:50267206-50267228 CAGGGACCGGCTGGGGTGGCCGG - Intergenic
956879773 3:73498968-73498990 GAGATACAAGCTGGGGTAGCAGG + Intronic
958406594 3:93762452-93762474 CACCTACAAGATGGGGTGGCCGG + Intergenic
959683197 3:109118842-109118864 CAGGTAGAAGGTAGGGGTGCGGG + Intergenic
960324116 3:116274127-116274149 CAGTTAGAAGGTGGGGTAGGGGG - Intronic
960954485 3:123022197-123022219 CAGTTACAGAGTGGGGAGGCTGG - Intronic
961721701 3:128901358-128901380 CTGGTACAAGGGGCTGTGGCTGG - Intronic
963266301 3:143243270-143243292 GAGGTATAGGGTGGGGTGGAGGG + Intergenic
964485188 3:157179073-157179095 CAGCTCCCAGATGGGGTGGCTGG + Intergenic
964485254 3:157179334-157179356 CAGCTCCCAGATGGGGTGGCTGG + Intergenic
966547879 3:181171281-181171303 GAGGAACAAGGAGGGGTGGGAGG + Intergenic
968057228 3:195701525-195701547 GAGGAACCAGGTGGGCTGGCTGG + Intergenic
968549708 4:1215928-1215950 CAGGTACAGGTGGGGGTGTCAGG - Intronic
968676230 4:1881949-1881971 CAGGAAGAAGCTGGTGTGGCTGG + Intronic
969301589 4:6300398-6300420 CTGGTAGAAGGTGGGGAGCCAGG + Intronic
969606006 4:8202618-8202640 CAGATGGAAGGTGGGGTGCCGGG + Intronic
970661272 4:18288296-18288318 CAGACTCATGGTGGGGTGGCTGG + Intergenic
974300951 4:60066953-60066975 CAGACACAAGTTGGGGTGGCTGG + Intergenic
974870760 4:67638149-67638171 CAGACAGAAGGAGGGGTGGCAGG + Intronic
976946863 4:90781031-90781053 CAAGAACAAGGAAGGGTGGCTGG + Intronic
977222279 4:94352081-94352103 CAGGCACTTGGTGGGGAGGCTGG - Intergenic
980219975 4:129901743-129901765 GAGGTAGAAGGTGGAGTGGAAGG - Intergenic
983679752 4:170339754-170339776 GAGGTACAAGCTGGAGTGGTGGG - Intergenic
986769386 5:10957924-10957946 GAGGTCCAAGATGGGATGGCAGG - Intergenic
990941260 5:61205244-61205266 CACTTCCCAGGTGGGGTGGCTGG - Intergenic
991962415 5:72058389-72058411 CAGGCAGAAGGAAGGGTGGCTGG - Intergenic
992933819 5:81680084-81680106 CAAGAACAGGGTGGGGTGGCAGG - Intronic
993116198 5:83722370-83722392 GAGGTGCAAGGTGGGATGGGAGG + Intergenic
995190073 5:109310356-109310378 CAGGTCCCAGGCGGGGTGGCAGG + Intergenic
995582351 5:113615341-113615363 CAAGGACAAGGTGGGGTGGAAGG + Intergenic
995760947 5:115561374-115561396 CAGGTAGAAGAGGGGTTGGCAGG + Intergenic
995952400 5:117731986-117732008 GAGGTACATGTTGGGGTGGAAGG - Intergenic
995983561 5:118139981-118140003 CTGGTATGAGGTGGGGTGGAGGG - Intergenic
996549813 5:124718188-124718210 GATGTACAAGTTGGGATGGCAGG - Intronic
997528870 5:134570184-134570206 CAGGTATGAGGTGGGGTGTGCGG - Intronic
998401234 5:141850125-141850147 CAGGTGCAGGATGGGGTGGGAGG - Intergenic
1000253254 5:159514815-159514837 CAGCAACAGGGTGGGGTGGGGGG - Intergenic
1000990238 5:167904290-167904312 CAGGTAGGATGTGGGGTGGCAGG - Intronic
1001937652 5:175716745-175716767 GAGGTACAGTCTGGGGTGGCAGG + Intergenic
1002101745 5:176861330-176861352 CAGGTTCAGGATGGGGTGGATGG + Intronic
1002292406 5:178208995-178209017 CAGGACCAAGGTGTGGTGCCTGG + Intronic
1002454776 5:179339719-179339741 CAGTGCCAAGGTGGGGTGGGAGG + Intronic
1003445970 6:6184739-6184761 CATATTCAAGGTGGGGGGGCAGG - Intronic
1004018516 6:11754698-11754720 CAGGAACAAGGTGTGGGGGCTGG + Intronic
1004151079 6:13120553-13120575 GAGGCCGAAGGTGGGGTGGCTGG + Intronic
1004387337 6:15184460-15184482 CAGGTAAAATGTGGAGTGGGGGG - Intergenic
1004713110 6:18191314-18191336 CAGGTACATGGTGGGGTCTCGGG - Intronic
1006945343 6:37780664-37780686 CAGGTGCAGAGTGGGGTGGTGGG + Intergenic
1007163645 6:39812584-39812606 CAGGGGCAGGGTGGGGAGGCGGG - Intronic
1007794166 6:44334241-44334263 CAGGAACAAGGTGGAGAGGATGG + Intronic
1008061116 6:46998100-46998122 CGTGTCCAAGGTGGGGTGGAAGG - Exonic
1011394507 6:86891917-86891939 AAGCTACAAGGGTGGGTGGCAGG - Intergenic
1013931014 6:115532938-115532960 CAGGTAGAAAGTGGGGGGGTGGG - Intergenic
1017203889 6:151784791-151784813 AAGGCACAAGTTGGGGTGGGGGG - Intronic
1018302585 6:162419055-162419077 CAGGTGCAAGCAGGGGCGGCAGG + Intronic
1019474191 7:1236220-1236242 CGGGTAGAAGGCGGGGTCGCAGG - Exonic
1019578635 7:1749460-1749482 CAGGTCCCTGGTGGGGTGACCGG - Intergenic
1019618774 7:1979399-1979421 TGGGCACAGGGTGGGGTGGCAGG - Intronic
1019736051 7:2650178-2650200 CAGGAACTATGTGGGGTGGCGGG + Intronic
1021239371 7:18181710-18181732 CAAGCACAAGGTGGGGTAGGGGG - Intronic
1021597787 7:22335549-22335571 TGGGGACAAGGTGGGGTGGGTGG + Intronic
1022034021 7:26517197-26517219 CAGCTACAAGCTGAGGTGGGAGG - Intergenic
1023410785 7:39887118-39887140 CATGTCCAAGGTGGGGCTGCAGG + Intergenic
1023500898 7:40848298-40848320 CAGGTACAAGGTAGAGTGGATGG - Intronic
1023868253 7:44249159-44249181 CAGGAACAAGGAGGAGGGGCTGG - Intronic
1023908750 7:44539563-44539585 CAGGTAGAAGGTGGAGTCGAGGG + Exonic
1024349261 7:48347154-48347176 CAGGTACTAGGTGGTGTTCCAGG + Intronic
1026052126 7:66955746-66955768 CAAGTCCAAGGTGGGGTTGAAGG - Exonic
1026578448 7:71594175-71594197 CAGGGACCAGCTGGGGTGGATGG + Intronic
1027222068 7:76220537-76220559 CAGGGCCAAGATGGGGTGTCCGG - Intronic
1028512932 7:91644949-91644971 CAGTTACGGGGTGGGGAGGCCGG - Intergenic
1028645452 7:93091285-93091307 CAATTAAAAGGTGGAGTGGCTGG - Intergenic
1029420048 7:100467675-100467697 CAGGTACAGGGGGGTGTGGGCGG - Intronic
1032030259 7:128477079-128477101 CAGGGACAATGTGGAGTGGTCGG + Exonic
1032196574 7:129792802-129792824 CAGGCACAGGCTGGGATGGCAGG - Intergenic
1033120570 7:138664190-138664212 CAGGTAGAAGGTGGGGGAGGGGG - Intronic
1033509314 7:142039068-142039090 CAGGAACAAGACGGGGTGGGGGG + Intronic
1035179008 7:157075959-157075981 CTGGTAAAAGCTGGGGTGGAAGG - Intergenic
1035714869 8:1746293-1746315 CAGTCACAAGCTGGGGTGGGTGG - Intergenic
1035941492 8:3906124-3906146 CTGGTACACTGTGGGGTGGAAGG - Intronic
1036613090 8:10366637-10366659 CAGGTACAAGCAGGGGATGCGGG - Intronic
1037889438 8:22615804-22615826 CAGGTTCTAGGGGGGGTGGAGGG - Exonic
1038439907 8:27564524-27564546 CAGGTAAAAGATGGGAGGGCAGG - Intergenic
1039103000 8:33960414-33960436 TAGGTACAAAGTGGTGTGGTTGG - Intergenic
1040461404 8:47652447-47652469 CAGCTCCAAGGTGGGCGGGCTGG + Intronic
1040878257 8:52175484-52175506 GGGGTATAAGGTGGTGTGGCTGG + Intronic
1040957016 8:52989788-52989810 TAGGTGCAATGTGGGGTGGCAGG + Intergenic
1041560112 8:59208109-59208131 ATGGTACAAGGTGGAGTAGCAGG + Intergenic
1043467669 8:80528488-80528510 CAGGGACAAGGTGCGGGGGAAGG - Intergenic
1044582025 8:93833833-93833855 CACTTCCCAGGTGGGGTGGCCGG + Intergenic
1046785343 8:118259782-118259804 CAGGTACAAAGTGGGGAGTAAGG - Intronic
1047723272 8:127662135-127662157 CATGTCCAATGTGGGTTGGCAGG - Intergenic
1048581764 8:135734836-135734858 CAGGAAAAAGGTGGGGGGGCAGG - Intergenic
1049615033 8:143572343-143572365 TAGGTGGAAGGCGGGGTGGCAGG - Intronic
1049913001 9:287894-287916 CAGGAACAAGCTGCGGTGACTGG - Intronic
1050830902 9:10011100-10011122 CAGGTATAAGGTGTGGTGAAGGG - Intronic
1054911262 9:70457401-70457423 CTGGTACAGGGTGTGGTGGGTGG + Intergenic
1055708314 9:79032804-79032826 CCGCTGCAAGGTGGGGTGACGGG + Intergenic
1056079239 9:83073370-83073392 GGGGTAGAAGGTGGGGTGGTGGG - Intergenic
1056140321 9:83671993-83672015 AAGGTACAAGGTGAGGTAGCAGG - Intronic
1056384134 9:86081522-86081544 CAAATACAAGAGGGGGTGGCAGG + Intronic
1057051020 9:91924279-91924301 CAGGGACTAGGAGGGATGGCCGG - Intronic
1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG + Exonic
1058805187 9:108583633-108583655 AAGGTGAAAGGTGGGGTGGGAGG - Intergenic
1059449639 9:114362386-114362408 CAGGTACCTGCTGGGGTGGAAGG - Exonic
1061130406 9:128704970-128704992 CCGCTACCGGGTGGGGTGGCTGG + Intronic
1061422436 9:130479635-130479657 GAGGGAGAGGGTGGGGTGGCGGG + Intronic
1062317847 9:135977272-135977294 CTGGTGCAGGGTGGGGTGGTGGG + Intergenic
1062494359 9:136824858-136824880 CAGGAAGAGGGTGCGGTGGCAGG - Intronic
1185491187 X:518202-518224 CAGGGACCAGTTGGGGTGGGAGG + Intergenic
1186359663 X:8827113-8827135 TAGGTGCAAGGTGGGGTGATGGG + Intergenic
1190172477 X:48122439-48122461 CAGGTGCAAGAAAGGGTGGCTGG + Intergenic
1190178122 X:48168090-48168112 CAGGTGCAAGAAAGGGTGGCTGG + Intergenic
1190180023 X:48184341-48184363 CAGGTGCAAGGAAGGGTGGCTGG - Intergenic
1190193040 X:48293561-48293583 CAGATACAAGGAAGGGTGGCTGG - Intergenic
1190197252 X:48329874-48329896 CAAGTGCAAGGAAGGGTGGCTGG + Intergenic
1190204955 X:48395119-48395141 CAGGTGCAAGGAAGGGTGGTTGG + Intergenic
1190205581 X:48400284-48400306 CAGGTGCAAGGAAGGGTGGTTGG - Intergenic
1190225178 X:48539702-48539724 CCGGCACGAGGTGGGGCGGCGGG + Exonic
1190658776 X:52635686-52635708 CAGGTGCAAGGAAGGGTGGCTGG + Intergenic
1190659547 X:52642174-52642196 CAGATACAAGGAAGGGTGGCTGG - Intergenic
1190663983 X:52680250-52680272 CAGGTGCAAAGAAGGGTGGCTGG + Intronic
1190665775 X:52695008-52695030 CAGGTGCAACGTAGTGTGGCAGG - Intronic
1190673643 X:52763402-52763424 CAGGTGCAACGTAGTGTGGCAGG + Intronic
1190675439 X:52778172-52778194 CAGGTGCAAAGAAGGGTGGCTGG - Intronic
1190677182 X:52792170-52792192 CAGATACAAGGAAGGGTGGCTGG + Intergenic
1192204270 X:69085841-69085863 CAGCTAGAGGGTGGGCTGGCGGG - Intergenic
1196622817 X:117842646-117842668 AAGGGGAAAGGTGGGGTGGCAGG + Intergenic
1199863515 X:151822699-151822721 CAGATACAAGGAGTGGTGGGAGG + Intergenic
1200393631 X:155969278-155969300 CAGGTCCAGGGTGTGGTGCCGGG + Intergenic
1200954850 Y:8933196-8933218 CAGGTCCAAAGTTGGGGGGCAGG + Intergenic
1201017584 Y:9622188-9622210 CAGGGACAGGGTGGGGCAGCAGG - Intergenic