ID: 1162182018

View in Genome Browser
Species Human (GRCh38)
Location 19:8876431-8876453
Sequence ACTGAGCTGCAGAGGGAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 518}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162182006_1162182018 25 Left 1162182006 19:8876383-8876405 CCTGCAGCCTGTGTACCGTGCAC 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG 0: 1
1: 1
2: 2
3: 70
4: 518
1162182005_1162182018 26 Left 1162182005 19:8876382-8876404 CCCTGCAGCCTGTGTACCGTGCA 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG 0: 1
1: 1
2: 2
3: 70
4: 518
1162182009_1162182018 10 Left 1162182009 19:8876398-8876420 CCGTGCACCCAGGCTGCTCCTCT 0: 1
1: 0
2: 2
3: 55
4: 489
Right 1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG 0: 1
1: 1
2: 2
3: 70
4: 518
1162182008_1162182018 18 Left 1162182008 19:8876390-8876412 CCTGTGTACCGTGCACCCAGGCT 0: 1
1: 0
2: 1
3: 7
4: 145
Right 1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG 0: 1
1: 1
2: 2
3: 70
4: 518
1162182014_1162182018 -8 Left 1162182014 19:8876416-8876438 CCTCTGGAACAAAGGACTGAGCT 0: 1
1: 0
2: 2
3: 66
4: 614
Right 1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG 0: 1
1: 1
2: 2
3: 70
4: 518
1162182011_1162182018 3 Left 1162182011 19:8876405-8876427 CCCAGGCTGCTCCTCTGGAACAA 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG 0: 1
1: 1
2: 2
3: 70
4: 518
1162182012_1162182018 2 Left 1162182012 19:8876406-8876428 CCAGGCTGCTCCTCTGGAACAAA 0: 1
1: 0
2: 0
3: 17
4: 167
Right 1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG 0: 1
1: 1
2: 2
3: 70
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162182018 Original CRISPR ACTGAGCTGCAGAGGGAGAA GGG Exonic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900628752 1:3622700-3622722 TCAGGGCTGCAGAGGGAGCATGG + Intergenic
900793010 1:4691922-4691944 AGGGACCTGCAGAGGGACAAGGG + Intronic
901139712 1:7020763-7020785 ACAGAGCTGGAGAGGGACCAGGG + Intronic
901232240 1:7647653-7647675 ACTGAGCTGGAGAGGAAAAAAGG - Intronic
901422162 1:9158487-9158509 ACTGCCCTGCAGAGGGAGAGAGG - Intergenic
901797021 1:11685545-11685567 ACTGAGGTTCAGAGAAAGAAGGG - Intronic
902050512 1:13560676-13560698 AAGGACCTTCAGAGGGAGAAAGG + Intergenic
902735071 1:18395162-18395184 ACTGAGGCCCAGAGGGAGAGAGG + Intergenic
903240284 1:21978233-21978255 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903244033 1:22002867-22002889 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903935840 1:26894292-26894314 ATTGAGCTCAAGTGGGAGAAGGG - Exonic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904376086 1:30083375-30083397 TCTGTCCTGCAGATGGAGAAAGG - Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
905491653 1:38348935-38348957 ACAGAGCTGGAGAGGGAAAGAGG - Intergenic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
905696136 1:39975064-39975086 ATTGAGATGGAGAGGGAGAGGGG + Intergenic
906937788 1:50229465-50229487 ACTGAGATTCAGAGAGGGAAAGG - Intergenic
907275342 1:53313877-53313899 ACTCAGCTGCAGAGCGAAGATGG + Intronic
907933410 1:59020579-59020601 CCAGAGCTGTAGAGGGAGAAGGG - Intergenic
908717688 1:67087650-67087672 ACTTAGCTGCACAGGAACAAGGG - Intergenic
910028619 1:82688927-82688949 ACAGAGCTGCAGTGGGTGCATGG - Intergenic
910806349 1:91192718-91192740 ACTGGGCTTCAGAGGGAGTGGGG + Intergenic
911380158 1:97104686-97104708 AATAAACAGCAGAGGGAGAAGGG + Intronic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
912051564 1:105535675-105535697 ACAGGGCTGGAGAGTGAGAATGG + Intergenic
912624748 1:111197711-111197733 CCTGACCAGCAGCGGGAGAAGGG + Intronic
912883514 1:113444280-113444302 ACAGAGGTGCAGAGAGAGGATGG + Intronic
912935275 1:113998484-113998506 AATGAACTGCAGAGGGAAAGAGG + Intergenic
912938334 1:114023289-114023311 ATTGAGCTGCAGACATAGAAAGG + Intergenic
913387258 1:118272160-118272182 ATCTAGCTGCAGAGGGAGAAAGG + Intergenic
915741988 1:158125749-158125771 ACTGAGCTGTGGAGGGGGGATGG - Intergenic
916852642 1:168719234-168719256 ATGGAGCTGCAGGGAGAGAACGG - Intronic
917546469 1:175973991-175974013 ATTGAGCTGGAGAGGGAGGTGGG + Intronic
918081516 1:181211247-181211269 ACTGACCTCCAGAGTGAGATGGG - Intergenic
918191663 1:182181431-182181453 GCTGAGCAGCAGAGTGAGCATGG - Intergenic
920235412 1:204500084-204500106 CCTGAGCTGGAGGGGGTGAATGG + Intergenic
921552327 1:216553184-216553206 CCTGGGCTGCAGAGGGAGAGAGG - Intronic
921676612 1:217983161-217983183 AGTGAGCTGTTGAGGGAGGAGGG + Intergenic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
922469787 1:225868946-225868968 TCTGTGCTACAGAGGGAGAAGGG + Intronic
924449561 1:244165307-244165329 ACTGTAGTGCAGAGGGCGAAAGG + Intergenic
1062838658 10:652537-652559 ACGGAGCTGCAGTGGGAGGCGGG + Exonic
1062954220 10:1529659-1529681 ACTGAGTTGCAGGGGCAGAGGGG - Intronic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064745875 10:18477668-18477690 AGTGGGCTGCAGAGGGAAGATGG + Intronic
1064984216 10:21193599-21193621 ACTGAGCAACAGAAGGACAAAGG + Intergenic
1065162854 10:22941143-22941165 ACTGATCTGCAGTGGAAGAAAGG + Intronic
1067279519 10:44860805-44860827 ACTGAGATTCAGAAAGAGAAAGG - Intergenic
1067741382 10:48898254-48898276 CCTGAGCAGCAAAGGGAGTAGGG + Intronic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070775463 10:79107347-79107369 ACTGAGGCACAGAGAGAGAAAGG - Intronic
1070939251 10:80328857-80328879 ACTGAGCAGTGGTGGGAGAAGGG - Intergenic
1072583794 10:96763869-96763891 ACAGAGCTGCATAGGGATGAAGG - Intergenic
1072723963 10:97800243-97800265 CCTGGGCTTTAGAGGGAGAAAGG + Intergenic
1072788165 10:98298637-98298659 ACTGACCTACAGAGGGAATAAGG + Intergenic
1072790744 10:98315958-98315980 ACTGAGAGGTAGAGGGACAAAGG - Intergenic
1073850105 10:107605456-107605478 ACAGAGCTGGAGAGAGGGAAAGG - Intergenic
1073923537 10:108486800-108486822 AAAGGGCTTCAGAGGGAGAATGG - Intergenic
1074339738 10:112615858-112615880 AGTGAGGTGCACAGGGAGTAAGG + Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1076280464 10:129242259-129242281 GCTGGGGTGGAGAGGGAGAATGG + Intergenic
1076413166 10:130265911-130265933 ACGAAGCTGCAGATGGAGACGGG + Intergenic
1076598004 10:131637896-131637918 ACTGAGCTGCAGAGGAGGGGAGG - Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1076761931 10:132610322-132610344 ACAGAGCTGCAGGGGCAGAGGGG - Intronic
1076811990 10:132891360-132891382 CCTGAGCTCCAAAGGGAGAGGGG - Intronic
1077204071 11:1333172-1333194 AGTGGGCTGCAGAGAGAGAGTGG + Intergenic
1077330457 11:1981906-1981928 GATGCGCTGCAGAGGGAGAGGGG - Intronic
1077849923 11:6066384-6066406 ACTTAGCTTCAGAGAAAGAAGGG - Intergenic
1078632156 11:13012494-13012516 ACTGAGCTGCAGAGGGAAATCGG - Intergenic
1079249688 11:18778418-18778440 ACTGTGTCACAGAGGGAGAAGGG - Intronic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1080721653 11:34855043-34855065 GATGAACTGCAGAGAGAGAAAGG + Intronic
1081409832 11:42744878-42744900 AGAGAGCTGCATAGGCAGAAAGG + Intergenic
1081671872 11:44947037-44947059 ACTGTGCTGAAGAGGGCGAGAGG + Intronic
1082896008 11:58190769-58190791 ACTGAGCTGCACAGCGAGCCTGG - Exonic
1082965403 11:58961953-58961975 ACTGAGGTGCAAAGAAAGAAGGG + Intronic
1082999870 11:59281430-59281452 ACTTAGTTCCAGAGGGAGGAAGG + Intergenic
1084683637 11:70681197-70681219 GCTGAGCAGCAGAGAGAGAACGG - Intronic
1084708416 11:70829409-70829431 CCTGGGCTGCCCAGGGAGAAGGG + Intronic
1084857917 11:72000682-72000704 ACTGGGTTGGGGAGGGAGAATGG - Intronic
1085217993 11:74849062-74849084 GCTGAGGAGGAGAGGGAGAATGG - Intronic
1085309434 11:75507403-75507425 ACTGAGGCCCAGAGGGAGAAAGG + Intronic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1086286593 11:85258973-85258995 ACTGAGCTTCATAGAGAGTAAGG + Intronic
1086329934 11:85743890-85743912 ACTGACCAGCTGAGGGAGGAGGG - Intronic
1087131638 11:94673859-94673881 AGTGAGCTGCAGATGGTCAATGG - Intergenic
1088787010 11:113191165-113191187 ACTGAGCTATAGAGACAGAAGGG + Intronic
1088807808 11:113367906-113367928 ACTGAATTGCAAAGGGAGAACGG + Intronic
1089164829 11:116467843-116467865 AATGAGCTTAAGAGGGGGAAAGG - Intergenic
1089460875 11:118652759-118652781 AGAGACCAGCAGAGGGAGAAGGG + Intronic
1089690579 11:120184551-120184573 AATGAGCAGCAGAGGAGGAAAGG - Intronic
1089959697 11:122604881-122604903 AGTGAGCAGCAGAGTGAGTAGGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090236903 11:125154912-125154934 ACTGTGCTGCACAGGGAGGGTGG - Intergenic
1090355765 11:126139478-126139500 ACAGAGCTGGAGAGGAAGAACGG + Intergenic
1090455906 11:126849607-126849629 AATCAGCTGCAGAAGGAGAAAGG + Intronic
1091157371 11:133386074-133386096 AATGAGCTGAAGTGTGAGAATGG + Intronic
1202813435 11_KI270721v1_random:37085-37107 GATGCGCTGCAGAGGGAGAGGGG - Intergenic
1091629937 12:2152426-2152448 ACACGCCTGCAGAGGGAGAAAGG - Intronic
1091832572 12:3560328-3560350 ACGGAGGTGGAGAGGGAGAGAGG - Intronic
1091968593 12:4766305-4766327 ACTGAGCTTCAGAGAGGGTAAGG - Intronic
1092440755 12:8499845-8499867 ATTTAACTGCAGAGGAAGAAGGG - Intergenic
1093726914 12:22523603-22523625 GGTGAGCTGCAGAGGAAGATTGG - Exonic
1094474731 12:30832495-30832517 GCTGAGCTGAAGACGCAGAATGG + Intergenic
1094646258 12:32327620-32327642 GCTGAGCTGGACGGGGAGAAGGG + Exonic
1094701819 12:32877816-32877838 ACTGAACTGCAGAGTCAGGAGGG + Intronic
1095283485 12:40384140-40384162 ACTTAGCTGCACAGGAACAATGG - Intergenic
1095284214 12:40389299-40389321 ACTTAGCTGCACAGGAACAATGG - Intergenic
1095744953 12:45647679-45647701 ACTGAGCTGTAGAATGAGAATGG + Intergenic
1096240232 12:49955879-49955901 ACTGAGCTGGGGAGGGAGGCAGG + Exonic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1096751103 12:53759300-53759322 AGTGAACAGCATAGGGAGAAAGG + Intergenic
1097200126 12:57271163-57271185 AATGACCTCCAGAGGGAGTAAGG - Intronic
1097369172 12:58755402-58755424 AGAGAGATGGAGAGGGAGAAAGG + Intronic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1102020595 12:109679668-109679690 ACTAAGGTCCAGAGGGGGAAAGG + Intergenic
1102708526 12:114904912-114904934 ACTCAGCTGCATAGTGAGATGGG + Intergenic
1103033978 12:117641521-117641543 ACAGAGATGCACAGGGAGAAAGG - Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1103926068 12:124423875-124423897 ATTGAGGTTCAGAGGGGGAATGG + Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1105471473 13:20698807-20698829 ACTGAGGTGCTGTGGGACAAAGG + Intergenic
1105842123 13:24263387-24263409 AGTGAGATGTAGGGGGAGAAGGG - Intronic
1106186258 13:27412533-27412555 ACTGAGATGGAGAGGGCCAAGGG + Intergenic
1107606719 13:42064580-42064602 ACTGAGCAGCTGAGGTAGGAAGG + Intronic
1108305658 13:49129654-49129676 ACTGAGTTAAATAGGGAGAAAGG + Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108731403 13:53239269-53239291 AGTAAGCTGCAAAGGGAGACTGG - Intergenic
1110718316 13:78732846-78732868 CCTGAATTCCAGAGGGAGAAGGG - Intergenic
1111257275 13:85686860-85686882 AAGGATCTTCAGAGGGAGAAAGG + Intergenic
1111709758 13:91796230-91796252 ACTTAGCTGCACAGGAACAATGG + Intronic
1112190712 13:97174896-97174918 TGTGAGCTGAAGTGGGAGAAAGG - Intergenic
1112640836 13:101273209-101273231 CCTGAGCAGCAGCGGGAAAACGG + Intronic
1114452413 14:22836153-22836175 TGAGACCTGCAGAGGGAGAAGGG - Intergenic
1114752304 14:25218712-25218734 TCTAAGCTGCTGAGGGATAATGG - Intergenic
1115975474 14:38992144-38992166 AATGAGGTGGAGAGGAAGAAGGG + Intergenic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1118977163 14:70687704-70687726 ACTGAGCTGCACAGAGACAATGG - Intergenic
1118990097 14:70790165-70790187 CCTGAGCAGCAGTGGGGGAAGGG + Intronic
1119319453 14:73720985-73721007 TCTGAGATTCAGAGGGAAAAAGG - Intronic
1119717851 14:76871359-76871381 ACTGAGGAGAAGAGTGAGAAGGG + Intergenic
1119772656 14:77230330-77230352 ACTGAGCTATAGAGTTAGAATGG - Intronic
1119781508 14:77279280-77279302 AGAGAGCTGCAGAGGCAAAAGGG + Intronic
1119878961 14:78085045-78085067 GCTGAGATGCAGAGAGAGTAAGG - Intergenic
1120551750 14:85881182-85881204 ACAAAGAGGCAGAGGGAGAATGG - Intergenic
1120697921 14:87665089-87665111 ACAGAGTTGCAGAGAGATAAGGG + Intergenic
1121427029 14:93859726-93859748 ACTGACCTGAACAGGGAGGAAGG - Intergenic
1121527018 14:94626100-94626122 AGTGAGCAGGAGAGGGAGAGAGG + Intergenic
1122039002 14:98968965-98968987 ACTGAGGCACACAGGGAGAAAGG + Intergenic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122282851 14:100634462-100634484 ACTGAACGGCAGAGGCAGGATGG - Intergenic
1122482617 14:102056878-102056900 GCTGAGCTGCAGCGGGAGTTGGG - Intergenic
1122826888 14:104374914-104374936 ACACAGCTGCTGGGGGAGAAAGG - Intergenic
1124049029 15:26177919-26177941 ACCCAGCTGCATAGAGAGAATGG - Intergenic
1124375844 15:29128210-29128232 CCTTAGCAGCAGAGGGAGAAAGG - Intronic
1125832652 15:42727769-42727791 GCTGTGGGGCAGAGGGAGAATGG + Exonic
1128546198 15:68569846-68569868 ACCGAGGTGCAGAGAGTGAAAGG + Intergenic
1129086695 15:73101435-73101457 AAAGAGCTGCAGAGAGAGAGTGG - Intronic
1129342980 15:74898131-74898153 CCTCAGCTGCAGAGGAGGAAAGG + Exonic
1129384037 15:75185843-75185865 ACTGAGGGGGAGATGGAGAACGG + Intergenic
1129660921 15:77552486-77552508 ACTGAGGCACAGAGGGAGAAGGG - Intergenic
1129662921 15:77563133-77563155 ACTGAGCTGCAAAGTGACATTGG + Intergenic
1129703928 15:77783885-77783907 ACTGAGGTGCAAACGGAGAAAGG - Intronic
1130059733 15:80560814-80560836 GCTGAGCTGCAGAGTAAGTAAGG - Intronic
1130671473 15:85916818-85916840 ACTGTGCTCCAGAGGCTGAACGG - Intergenic
1131112016 15:89770482-89770504 TCTGGGCTGCAGAGTGAGACAGG - Intronic
1131272992 15:90958007-90958029 ACAGTGCTGCCGAGGGAGTATGG + Intronic
1131465597 15:92652796-92652818 AAGGAGTTGCAGAGGGAGAAAGG + Intronic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1133395294 16:5442304-5442326 GCGGAGCTGCAGAGGGAGCCAGG + Intergenic
1134095468 16:11415707-11415729 ACTGGACAGCAGTGGGAGAAGGG + Intronic
1134260803 16:12649386-12649408 AGTCAGTTGCAGAGGTAGAATGG + Intergenic
1135615571 16:23908222-23908244 ACAGTGCTGCAGAGGGAAAAAGG + Intronic
1135668364 16:24354425-24354447 GCTGGGCTGAGGAGGGAGAATGG + Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136565055 16:31064799-31064821 ACTGAGCTGAAGAAGGAAGATGG - Exonic
1137521214 16:49196882-49196904 ACTGAGGAGCAGAGAGGGAAAGG - Intergenic
1137565354 16:49529395-49529417 CCTGAGCAGAGGAGGGAGAAAGG - Intronic
1137850607 16:51738346-51738368 ACTGAGGCCTAGAGGGAGAAAGG - Intergenic
1137955589 16:52825685-52825707 AATGAGTTGCAGAGGGAGGCAGG - Intergenic
1138391792 16:56675805-56675827 ACTGTGCGGGGGAGGGAGAATGG + Intronic
1139077586 16:63471671-63471693 ACTTAGCTGATGAAGGAGAAGGG + Intergenic
1139163090 16:64534951-64534973 AGTGAGCAGCAAAGGGGGAAGGG - Intergenic
1139526276 16:67518677-67518699 ACTGAGTTCCAGAGGGAGCAAGG - Intronic
1140408728 16:74728351-74728373 GCTGAGATCCAGAGGCAGAATGG + Intronic
1140442937 16:75000426-75000448 ACAGTGCTGCAGTGGCAGAATGG - Intronic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1141770970 16:86089478-86089500 ACTGAGCTGCACACGGAGCTGGG - Intergenic
1142066711 16:88067147-88067169 ACAGAGCTGCAAAGGGTCAAAGG - Intronic
1143055299 17:4157890-4157912 ACTGAGCGGCAAAGGGAGCTGGG - Intronic
1143183456 17:4997778-4997800 ACCGAGCTGCGGACGCAGAAGGG - Intergenic
1143716700 17:8776875-8776897 ACCAAGCTGGAGAGGGAGAGAGG + Intergenic
1143871695 17:9961278-9961300 ACAAAACTGCACAGGGAGAAAGG + Intronic
1144080862 17:11762696-11762718 TCTGAGGTGAAGAGGTAGAAGGG + Intronic
1145305660 17:21673717-21673739 ACAGAGCTAAAGAGTGAGAAAGG + Intergenic
1146022666 17:29293000-29293022 ACTGAGGAGCGGAGGGGGAAGGG - Intronic
1146595461 17:34164612-34164634 ACTGAGGTTCAGAGAGTGAAAGG + Intronic
1147692493 17:42325079-42325101 ACTGAGCTGGGGAGGCAGAGGGG + Intronic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149381619 17:56099954-56099976 AATGAGCAGAAGAGGGAGACTGG + Intergenic
1149912304 17:60577760-60577782 ACTGAGCTGAGGAGGGAGGGTGG + Intronic
1150275092 17:63892068-63892090 ACTGAACTGCACAGGCAAAATGG - Intergenic
1151023902 17:70654805-70654827 ACAGATGTGCAGAGAGAGAAAGG - Intergenic
1151261131 17:72916781-72916803 ATTGAGGTGCGGAGGGAGATGGG - Intronic
1151445528 17:74161081-74161103 ACTGAGCTGCACAGGCCGAGAGG + Intergenic
1151702267 17:75749849-75749871 CCTGAGCTGCCAAGGGAGAAAGG + Intronic
1151799175 17:76367502-76367524 CCTGAGCTACAGAGCGAGACTGG - Intronic
1152030545 17:77839612-77839634 ACTGAGCTGAGGAGAGAGGAGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153228786 18:2917787-2917809 ACTGAACTGCAAAGAGGGAAAGG + Exonic
1154329507 18:13418146-13418168 AGGAAGCTACAGAGGGAGAAAGG - Intronic
1155481039 18:26287919-26287941 AATGAGATGCAGAGTGGGAAGGG - Intronic
1156183177 18:34629911-34629933 ACTGGGCTGCTGAGGAAGCATGG - Intronic
1156192752 18:34738593-34738615 ACCGAGGTGCAGAGGGAACAGGG - Intronic
1156713355 18:39975739-39975761 AGTGAACAGCAGAGGGATAATGG - Intergenic
1156857863 18:41803577-41803599 GCTGAGCTGCATGGGAAGAAAGG - Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157670965 18:49528293-49528315 AGTGAGCTGGAGGGGGAAAAGGG - Intergenic
1157782328 18:50450533-50450555 ACAGAGCTGCAAAAGGAAAAAGG - Intergenic
1158857233 18:61554783-61554805 ACTGTGCTGGAGAGTGAGAATGG + Exonic
1159507346 18:69354510-69354532 AAAGAGCTGGAGAGGGGGAAGGG + Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160842897 19:1154397-1154419 CATGATCTGCAGAGGGAGACGGG + Exonic
1161658485 19:5530756-5530778 ACTGAGGCACAGCGGGAGAATGG - Intergenic
1161895034 19:7073886-7073908 ACAGAGCTGTAGAGGGTGGACGG - Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1163441471 19:17324375-17324397 AGTGAGCTGGAGCAGGAGAAGGG + Intronic
1163446214 19:17347855-17347877 GCTGGGCTTCAGAGGTAGAAGGG + Intergenic
1163786174 19:19275972-19275994 ACTGTGCTGCAGAGGGAGGTTGG - Intergenic
1163842990 19:19622758-19622780 TCTGAGCTGCAGAGAAAGACAGG + Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1164842824 19:31406288-31406310 ACTGGGCTGCAGAGTGTGACTGG - Intergenic
1164927455 19:32141205-32141227 ACTGAACTGCTGAGGATGAAGGG - Intergenic
1164943060 19:32266558-32266580 ATTGAGCTGCAGAACGTGAACGG + Intergenic
1165154639 19:33779536-33779558 ACAGCCCTGGAGAGGGAGAATGG - Intergenic
1165823216 19:38690395-38690417 ACTGAGCCGCACAGGAACAATGG - Intronic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
1167130927 19:47585237-47585259 ACTGAGCTGAAGATGGAAGACGG - Intergenic
925059054 2:876880-876902 TCCGAGCTGCAGAGAGTGAAAGG - Intergenic
925789810 2:7472537-7472559 ACTGAGCAGGAGATGGAGGAGGG - Intergenic
926056264 2:9775884-9775906 TCTGAGCTCCAGGGAGAGAAGGG + Intergenic
926137102 2:10344041-10344063 ACTGAGCTGTCGAAGGAGCAGGG + Intronic
926190274 2:10722555-10722577 ACTGAGGTGGAGAGAAAGAAAGG + Intronic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927207669 2:20620264-20620286 ACTGAGGTGCAGAGAGGCAAAGG + Intronic
927324082 2:21783002-21783024 ACTGTGCTGTAGAGAGAGCACGG + Intergenic
927521685 2:23702877-23702899 ACTGAGCTGGATAGAGAGGAGGG + Intronic
927542709 2:23927068-23927090 ACGGAGCTCGAGAGCGAGAACGG - Exonic
927714600 2:25343322-25343344 GCTGGGCTGCATGGGGAGAAGGG - Intergenic
928051834 2:28006211-28006233 TATGAACTGCAGAGGAAGAAAGG - Intronic
928347269 2:30511813-30511835 CCAGAGGTGCAGAGAGAGAAGGG + Intronic
928387458 2:30882688-30882710 TCTGAGTTGCAGAGGGGCAAGGG - Intergenic
928449795 2:31368005-31368027 CCTGAGCTGAAGATCGAGAAAGG - Exonic
928634510 2:33229364-33229386 ACTGAGAAGCTGAGGCAGAAGGG + Intronic
928671879 2:33610899-33610921 ACTTAGCTGCACAGGTACAATGG + Intergenic
929709386 2:44250812-44250834 AGTGAGCTGCATGGAGAGAAAGG + Intergenic
929907667 2:46060585-46060607 ACTGAGTTCCAGTGGGAAAAGGG + Intronic
930000962 2:46861228-46861250 ACAGAGATGGAGAGGGAGAAGGG - Intergenic
932211422 2:69934454-69934476 ACGGAGTGGGAGAGGGAGAAGGG - Intronic
932291623 2:70584899-70584921 ACTGAGCCTCAGAGAGAAAAGGG - Intergenic
932341748 2:70966899-70966921 CCTGGGCTGCAGAGTGAGACAGG + Intronic
932595799 2:73092846-73092868 ACTGGGTTGCAGAGGGAGGTGGG - Intronic
933368082 2:81380135-81380157 AGAGAGCAGCAGAGAGAGAATGG + Intergenic
934555910 2:95286924-95286946 TCTGAGGTGCAGAGTGAGATGGG - Intronic
935163710 2:100551261-100551283 ACTGAGCTGAAGTGGAAGAGTGG + Intergenic
935525738 2:104164165-104164187 ATAGAACTGCAGAGGGTGAAGGG - Intergenic
936626530 2:114155093-114155115 ATTGAGCTGCAGACATAGAAAGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937417542 2:121728728-121728750 ACAGAGCTGCAGAGGTTGAAGGG + Intronic
937681162 2:124646230-124646252 ACAGAGCTAGTGAGGGAGAAAGG + Intronic
938104731 2:128521942-128521964 GGAGTGCTGCAGAGGGAGAAGGG + Intergenic
938122638 2:128644737-128644759 AATGAGGTAGAGAGGGAGAAAGG - Intergenic
938376268 2:130808710-130808732 AGTGATCTGCAGAGGCAGAGTGG - Intergenic
941032900 2:160533241-160533263 ATTGTGCAGGAGAGGGAGAAAGG + Intergenic
941200683 2:162505223-162505245 ATAAAGCTGCAGAGGGTGAAAGG + Intronic
941295678 2:163736245-163736267 GCGGAGCTGGAGGGGGAGAAAGG + Intergenic
941694573 2:168537272-168537294 AATTATCTGCAGAGGGAAAATGG - Intronic
941694728 2:168538772-168538794 AATTATCTGCAGAGGGAAAATGG - Intronic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
942153953 2:173107472-173107494 GCTGACCTGCACAGGGATAAGGG + Intronic
942984089 2:182118854-182118876 ACAGAGAAGGAGAGGGAGAAGGG - Intronic
943008618 2:182418573-182418595 AATGAACTGCAGATGGAGTAAGG + Intronic
943317251 2:186405392-186405414 ATTCAGCTGCAGAGGAAGTATGG - Intergenic
944452084 2:199853448-199853470 ACTGAGCTGAAGAGGGTAAAAGG + Intergenic
945276639 2:207994399-207994421 ACAGTGATGCAGAGGGAAAAGGG + Intronic
945319139 2:208401597-208401619 GGTGTGCTGCAGAGGAAGAAGGG - Intronic
946162002 2:217841158-217841180 AAAGAGCTGGAAAGGGAGAAGGG + Intronic
946940020 2:224760715-224760737 ACTGAGGAGAAGAGGGAGATGGG + Intergenic
947397990 2:229705529-229705551 AGTGAGCACCAGAGGGAAAAGGG - Intronic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
947931867 2:233971502-233971524 TCTGAGGTGCAGATGGGGAATGG + Intronic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948389019 2:237598747-237598769 ACAGACCTGCAGTGGGAGACAGG - Intronic
1168808158 20:684992-685014 ACCTAGCTGCAGAGGGGGAGGGG + Intergenic
1169020797 20:2329439-2329461 AATGACCTGCAGAGGAAGACTGG - Intronic
1169059841 20:2653220-2653242 ACTGCGCCGCAGAGGCAGGAGGG + Intronic
1169081327 20:2799282-2799304 GCTGAGATGCAAAGGAAGAATGG - Intronic
1169896885 20:10513747-10513769 ACTCTGCTGCAGAGGGGCAATGG - Intronic
1170382698 20:15778832-15778854 ACTGACCAGCAAAGAGAGAAGGG + Intronic
1170413332 20:16113724-16113746 ATTGAGCTGCAGACATAGAAAGG - Intergenic
1170997432 20:21376700-21376722 AGTGAGGAGGAGAGGGAGAAGGG + Intronic
1171438973 20:25146519-25146541 ACTGTGCTGCAGGGTGAGAAAGG - Intergenic
1171495148 20:25549550-25549572 ACAGAGCAGGAGAGGGAGAGGGG - Intronic
1171532372 20:25861114-25861136 ACTGAGAGACAGAGAGAGAAGGG + Intronic
1171532699 20:25862791-25862813 ACTGAGAGACAGAGAGAGAAGGG + Intronic
1171847517 20:30286086-30286108 ACTGAGAGACAGAGAGAGAAGGG + Intergenic
1172013098 20:31857845-31857867 CCTGAGCTGCAGAGGTTGATGGG + Intronic
1172225357 20:33301923-33301945 ATTGAGGTCCAGAGGGGGAAAGG + Intronic
1172484793 20:35291726-35291748 ACTGAGGTCCAGAGAGGGAAGGG - Intronic
1172998421 20:39088320-39088342 TTCCAGCTGCAGAGGGAGAAGGG - Intergenic
1173193488 20:40894894-40894916 AATGAGGTTCAGAGGGGGAAAGG + Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173614710 20:44395195-44395217 ACGGAGCCTCAGAGGGTGAAAGG - Intronic
1173658761 20:44718753-44718775 ACTGAGCTCCAGAGAGGGACAGG - Intronic
1174090513 20:48043421-48043443 ACTGAGCTCCAGAGGAAGTAGGG + Intergenic
1174505771 20:51016517-51016539 CCTAAGCTGAAGAGGCAGAAGGG + Intronic
1175136853 20:56830743-56830765 ACTGAGCAGAAGAGGTAGAGGGG + Intergenic
1175225705 20:57442694-57442716 CCTGAGCTGCAGAGGGGCAGAGG - Intergenic
1175461944 20:59158380-59158402 TCTGTGCTGCACAGGGAGAGGGG + Intergenic
1176613802 21:9011120-9011142 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1176711390 21:10152769-10152791 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1179264343 21:39789473-39789495 ATTAAGCTCCAGAGGGATAATGG + Intronic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1180592651 22:16954313-16954335 ACGGGGCTGCAGTGGGAGGAGGG + Intergenic
1180595351 22:16969574-16969596 ACTGAGACCCAGAGGGAGAGGGG - Intronic
1180831567 22:18909638-18909660 ACACAGCACCAGAGGGAGAAGGG - Intronic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1181985548 22:26797888-26797910 ACTGAGCTTCAGATGGAGCAGGG + Intergenic
1182558501 22:31141617-31141639 ACTGTGTGGCAGAGGGGGAAGGG + Intergenic
1182676820 22:32045530-32045552 TCTGGGCTGCACAGGCAGAATGG + Intronic
1182692445 22:32173531-32173553 TGTGAGCAGCAGAGAGAGAATGG - Intergenic
1183403157 22:37616713-37616735 ACTGATCTGGAGAGGGAGCTGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183710199 22:39498841-39498863 CCTTAGCTGCAGGGGGAGCAGGG - Intergenic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1183962272 22:41418593-41418615 ACTGAACTGCATAGAGAGAGTGG + Intergenic
1183988869 22:41584753-41584775 ACCAAGCTGCAGAGGGAGAAAGG - Intronic
1184047300 22:41979439-41979461 GCTCAGCTGCAGAGGCATAAGGG + Intronic
1184985546 22:48130868-48130890 ACGGGGCTGCAGAGGGAGGCGGG - Intergenic
1203281651 22_KI270734v1_random:134909-134931 ACACAGCACCAGAGGGAGAAGGG - Intergenic
949999816 3:9648475-9648497 TGTGAGCAGCAGGGGGAGAAAGG + Intergenic
950656429 3:14439856-14439878 ACTGAGCCGCAGAGGGACAGTGG + Intronic
950788495 3:15454501-15454523 ACTGTGCACCAGAGGCAGAAGGG + Intronic
951105618 3:18738595-18738617 AATGTACTGCAGAGGGTGAAAGG - Intergenic
951860294 3:27244616-27244638 GCAGGGTTGCAGAGGGAGAATGG - Intronic
952053250 3:29412352-29412374 AGAGAACTGCAGAAGGAGAAGGG + Intronic
952066892 3:29581453-29581475 ACTGAGTTGCAGGGAGAGAGGGG - Intronic
952178571 3:30894086-30894108 TCAGAGCTGCAGATTGAGAACGG - Intronic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953210152 3:40868471-40868493 GGGTAGCTGCAGAGGGAGAATGG - Intergenic
953515846 3:43591320-43591342 ACTTAGCTGCACAGGAACAATGG - Intronic
954303781 3:49714952-49714974 ACTGAGCTGCAAGTGGAGAGCGG + Intronic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
955004371 3:54955253-54955275 GCAGAGCTGCACAGGGACAAAGG + Intronic
956378907 3:68645125-68645147 CCTGAGCTGCAGGGGGAGTAAGG - Intergenic
956784439 3:72630672-72630694 TTTTAGCTGCAGTGGGAGAAAGG + Intergenic
956998337 3:74853837-74853859 ATTGGGCTGCAGAGGGAAATAGG + Intergenic
957191116 3:77010946-77010968 ACAGAGAGGGAGAGGGAGAAAGG - Intronic
960534440 3:118801148-118801170 ACTTGACTGAAGAGGGAGAAAGG - Intergenic
961723825 3:128912821-128912843 ACTGAGCCGGAGAGAGAGAATGG + Exonic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962382341 3:134908301-134908323 ACTGAGCTGCAGAGTCACAGAGG - Intronic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
963429563 3:145181267-145181289 AGGGAGCTGCAGAGGCACAAAGG + Intergenic
964245419 3:154647071-154647093 ACTAAACTTCAGAGGAAGAAAGG + Intergenic
964411485 3:156402540-156402562 TCTGTTCTGCAAAGGGAGAAAGG - Intronic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966504049 3:180679340-180679362 GCTGAGCTGCACTGGGAGGATGG - Exonic
967038133 3:185663354-185663376 ACTGAGAGGCAGAGGGAGATGGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967197299 3:187039516-187039538 ACTGACCTTCAGAAGCAGAAAGG + Intronic
967263980 3:187673799-187673821 ATTGAGGTCCAGAGTGAGAAAGG - Intergenic
968035566 3:195544706-195544728 AGTGAGCTGGAAGGGGAGAAGGG + Intergenic
968064902 3:195753225-195753247 CCAGAGCTGCAGAGTGAGTAGGG + Exonic
968289226 3:197525864-197525886 ACAGACCTGCAGAGGGAGCACGG - Intronic
968289233 3:197525906-197525928 AGAGACCTGCAGAGGGAGCACGG - Intronic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
968869714 4:3235548-3235570 ACACATCTGCACAGGGAGAAAGG - Exonic
970234846 4:13948133-13948155 ACTGAGACTCAGAGGGATAAAGG - Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
970470737 4:16376989-16377011 AATGAGTTCCAAAGGGAGAAAGG + Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
975570705 4:75815074-75815096 ACTGTGGTGAAGATGGAGAATGG - Intergenic
975808194 4:78135453-78135475 ACTGATCTGCAGAGAAAGCATGG + Intronic
978533466 4:109737241-109737263 AAGGAGCTGGAGAGGGGGAAAGG - Intergenic
979567476 4:122171253-122171275 ACTAAATAGCAGAGGGAGAAAGG + Intronic
981632496 4:146836451-146836473 CATGAGCTGCAGTGGGAGAGAGG + Intronic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984849787 4:184143685-184143707 ACTGGGCTGCAGAGGGGCAGAGG - Intronic
984961761 4:185104150-185104172 ACTGAGCGGCAGTGAGAGAGTGG + Intergenic
985481267 5:112303-112325 TCTGGCCTGCAGTGGGAGAAGGG - Intergenic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
985896926 5:2754217-2754239 ACTGAGCTAAAGAGGGGGAAGGG - Intronic
986134515 5:4962433-4962455 AGTGAGTTGTAGAGGGGGAATGG - Intergenic
986157413 5:5190521-5190543 ATTGAGATACAGAGAGAGAAGGG - Intronic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
986561108 5:9061590-9061612 CCTGAGCTGCGGCAGGAGAAAGG + Intronic
986648376 5:9940406-9940428 ACAGACCTGGAGAGGGAGAAAGG + Intergenic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
987039463 5:14048096-14048118 ACTGATCTGAGGAGGAAGAATGG - Intergenic
987129638 5:14848651-14848673 ACTTAGCTGCACAGGAACAATGG - Intronic
987811416 5:22840948-22840970 ACAGAGCTGCAGAAGAACAAGGG + Intronic
988780970 5:34521652-34521674 ACAGAGGTGCACAGGGTGAAAGG + Intergenic
991270844 5:64778849-64778871 ACTGCCCTGCAATGGGAGAAGGG + Intronic
992516506 5:77499299-77499321 ACTGTGGTGCAGAAAGAGAAAGG + Intronic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993642073 5:90417555-90417577 ACTTAGCTGCACAGGAACAATGG + Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
995906589 5:117131374-117131396 AATAAGATGCAGAGGGAAAATGG - Intergenic
997334009 5:133091470-133091492 ACAGAGCTGCTGAGTGAGAGTGG + Intronic
997371718 5:133365781-133365803 CATGTGCTGAAGAGGGAGAATGG + Intronic
997661803 5:135594923-135594945 ACTGAGGTGCAGTGAGGGAAAGG + Intergenic
997741925 5:136262883-136262905 ACTGAGTTGAAGAGACAGAATGG + Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
997999090 5:138610059-138610081 AGTGAGCTGGAGAGGGAGTGTGG - Intergenic
998376154 5:141692269-141692291 ACTGAGCTCCAGCGGCCGAATGG + Intergenic
998797988 5:145839186-145839208 ACTGAGCTGCAGGGGCAGGAAGG - Intergenic
999070346 5:148737498-148737520 ACTGGACTTCTGAGGGAGAAAGG + Intergenic
999869595 5:155735482-155735504 ACTGAGGCTCAGAGGGGGAAAGG + Intergenic
999968545 5:156835622-156835644 ATGGAGTTGAAGAGGGAGAATGG - Intergenic
1001163952 5:169346644-169346666 TCTAAGGGGCAGAGGGAGAAGGG - Intergenic
1002651213 5:180696723-180696745 ACAGGGGTGCAGAGGGAGACAGG + Intergenic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1003121207 6:3320208-3320230 ACTGAGCTCCAGGGAAAGAAGGG - Intronic
1003329241 6:5115963-5115985 ACTGAGGGGAGGAGGGAGAAGGG + Intronic
1005280691 6:24270644-24270666 AGGGAGTTGAAGAGGGAGAAAGG + Intronic
1005316405 6:24606722-24606744 ACTAAGCTGCAAAGGGTGAGGGG - Intronic
1005469879 6:26152825-26152847 AGTGGGCTGAAGAAGGAGAAAGG - Intergenic
1005585984 6:27277044-27277066 ACTGAGCTGCAGAGTGGTACAGG + Intergenic
1005981713 6:30841756-30841778 ACTGAGGTGGAAAGGGAGAAAGG - Intergenic
1006929251 6:37677908-37677930 ACCCAGCTGCAGGGGGAGATAGG + Intronic
1006990760 6:38212847-38212869 AATGCGCTGCTGGGGGAGAAGGG - Intronic
1007103407 6:39267232-39267254 ACTGAGACCCAGAGAGAGAAGGG + Intergenic
1007206983 6:40160782-40160804 AGTGAGCAGCAGTGGGAAAAGGG - Intergenic
1007253150 6:40510143-40510165 ACTGTGCTGCACAGGTAGGAGGG + Intronic
1007821156 6:44561516-44561538 CCTGAGCTGCAGAAGGAAAGCGG - Intergenic
1010293399 6:74166895-74166917 AATGAGAAGCAGAGGAAGAAAGG - Intergenic
1011221879 6:85063404-85063426 ATTGAGCTGCAGAGAAAGCAGGG - Intergenic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1013481323 6:110555371-110555393 AATGAACTGCAGAGGTAGAGGGG - Intergenic
1014389515 6:120843353-120843375 TCTGACCTGCAGGGGCAGAAGGG - Intergenic
1014743939 6:125177607-125177629 AATGTGCTGCAGAAGGTGAAGGG - Intronic
1014904070 6:127004936-127004958 ACTGAGCACCAGATGGAAAATGG + Intergenic
1016002379 6:139055260-139055282 AGTTTGCTGCAGGGGGAGAAAGG + Intergenic
1016422263 6:143897802-143897824 ACAGAGTTACAGAGGGAGATGGG - Intronic
1016848857 6:148596083-148596105 ACAGAGCTACAGAGGCAGATGGG + Intergenic
1016904193 6:149132717-149132739 AGTGTGCTGGAGAGGGAGATGGG + Intergenic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018195867 6:161355930-161355952 ACTGAGATGGAAAGGGAGGAGGG + Intronic
1018205927 6:161436879-161436901 ACAGAGCTGCAGAGGGTGACCGG - Intronic
1018786402 6:167111446-167111468 ACTGACCTGCAGTGGGATATTGG + Intergenic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1019106623 6:169672997-169673019 ACTGGGCTGGAGAGACAGAAGGG + Intronic
1019146046 6:169976273-169976295 ACTGAGCTGTGGAGGGTGCACGG - Intergenic
1019165587 6:170095688-170095710 ATTGAGCTGCAGAGAAGGAAGGG - Intergenic
1019267383 7:125453-125475 ACTGAGGCCCAGAGGGAGAAGGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019607902 7:1919198-1919220 GCTGAGATGCAGAGAGAAAAGGG + Intronic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1019841422 7:3450012-3450034 GCTGCGCTCCAGAGGAAGAAAGG + Intronic
1020217067 7:6201310-6201332 ACTGAGCTGCAGGGGCAGGCAGG + Intronic
1020952426 7:14696605-14696627 ACTAATCTGCACAGGTAGAAAGG + Intronic
1021139706 7:17008943-17008965 ATTGAGCTGTAGAGGGAATAGGG + Intergenic
1021402525 7:20225987-20226009 ACTGAGATGCATAGGTAGAAAGG - Intergenic
1022243685 7:28536417-28536439 ACTGAGCTTCAGAGCTGGAAGGG - Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1022649073 7:32258494-32258516 ACTGATGTGCTGAGGGACAAGGG + Intronic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1025142592 7:56478518-56478540 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025610806 7:63074056-63074078 GATGAGCTGCAGAAGGAGCAGGG - Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025708653 7:63889119-63889141 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025988486 7:66476182-66476204 ACAGAGATGCAGAGGGAGCCTGG + Intergenic
1026004245 7:66588435-66588457 ACAGAGATGCAGAGGGAGTCTGG + Intergenic
1026192275 7:68140307-68140329 TCTGAGCAGCAGAGTGAGTAGGG - Intergenic
1026214760 7:68338457-68338479 ATTGAGCTGCAGACACAGAAAGG - Intergenic
1026624846 7:71982806-71982828 ACTGAGCTGCAGACATAGAAAGG + Intronic
1026627011 7:72003445-72003467 ACTGCACAGCAGAGGGAGAACGG + Intronic
1026978866 7:74515156-74515178 ACTGAGGCTCAGAGAGAGAAGGG + Intronic
1027211464 7:76152031-76152053 ACAGAGATGCAGAGGGAGCCTGG + Intergenic
1027935997 7:84603413-84603435 ACTGTACTGCGGAGGGAGAGGGG + Intergenic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028517960 7:91698814-91698836 ACTAAGCTCCAGAGGGGGTAAGG + Intronic
1028658507 7:93238467-93238489 ACTGGGCTGCAGAGGCAAATAGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1030369790 7:108685930-108685952 TCTGAGCTGCTGAATGAGAAGGG + Intergenic
1030991790 7:116309827-116309849 AATGAGCTGCAGAGAGAAAAGGG + Intronic
1031130936 7:117832567-117832589 ACAAAGCTTCACAGGGAGAAAGG - Intronic
1031640744 7:124161247-124161269 CCTGGGTTGCAGAGGCAGAAGGG - Intergenic
1031986389 7:128167054-128167076 CCCGAGCGGCCGAGGGAGAAAGG + Intergenic
1032303276 7:130709441-130709463 AATTAGTTGCAGAGGGTGAATGG - Intergenic
1032324720 7:130916527-130916549 ACCGAGTTGTAGAGGTAGAAGGG + Intergenic
1033323468 7:140360850-140360872 TGTGAGCTTCAGAGGGAGATGGG - Intronic
1034369625 7:150583690-150583712 AGTGAACAGGAGAGGGAGAATGG + Intergenic
1034717589 7:153257546-153257568 ACAGAACTCCAGAGGAAGAATGG + Intergenic
1034921995 7:155091030-155091052 ACTGAGCTGAAGGTGGAGATGGG - Intergenic
1035500350 8:87340-87362 AGGGAGATGGAGAGGGAGAAAGG - Intergenic
1036512937 8:9417433-9417455 ACTGAGCTGCAGAAGGCCTAGGG - Intergenic
1036546445 8:9774575-9774597 ACTGAACTGCAGAACTAGAAGGG - Intronic
1036590913 8:10167198-10167220 ACTCAGCTGCAGTGGGAGCCCGG - Intronic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1039207168 8:35169998-35170020 ACTGATCTGAAGAGTGGGAATGG + Intergenic
1040555926 8:48477725-48477747 ACTGAACCGCAGAGGGGCAAGGG - Intergenic
1041015845 8:53592525-53592547 ACTGAGATGAAGAGGGAGAGAGG + Intergenic
1042571305 8:70168173-70168195 ACTGGGCTGTAGAATGAGAAAGG + Intronic
1045242737 8:100416673-100416695 ACTCTGCTGCAGAGGGGGAGTGG - Intergenic
1045516401 8:102864067-102864089 GCAGAGCAGCAGAGCGAGAAAGG + Exonic
1045981824 8:108198523-108198545 ACTGAGCTGAAGAAATAGAATGG - Intergenic
1046538401 8:115547338-115547360 ACGGAGAGGCAGAGGGAGAGAGG - Intronic
1048149009 8:131874963-131874985 AGTGAGGTGAACAGGGAGAAAGG + Intergenic
1048955401 8:139531924-139531946 ACTAAGGTGGAGAAGGAGAAAGG + Intergenic
1049204088 8:141355319-141355341 ACTGAGGCTCAGAGGGAGAAAGG - Intergenic
1049285588 8:141773378-141773400 CCACAGGTGCAGAGGGAGAAGGG + Intergenic
1049645821 8:143735193-143735215 ACTGTGCTGCAGCGGGTGAGGGG + Intergenic
1050010823 9:1184411-1184433 TCTGAGGTGCAGAGAGAGAAGGG - Intergenic
1050541562 9:6674813-6674835 ACTTAGCTGAAAATGGAGAATGG - Intergenic
1050673110 9:8020132-8020154 ACTGAGCTGCACAGAGTGTATGG + Intergenic
1051563863 9:18473897-18473919 AGCGAGCAGCAGAGCGAGAAGGG - Exonic
1053004859 9:34597681-34597703 ACCGAGCTGGGGAGAGAGAAGGG + Intergenic
1053577134 9:39364348-39364370 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1053648378 9:40138460-40138482 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1053757360 9:41325381-41325403 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1053841638 9:42192273-42192295 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054098705 9:60923038-60923060 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054120105 9:61198667-61198689 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054329356 9:63736403-63736425 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1054536202 9:66237710-66237732 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1054587651 9:66983895-66983917 ACTGAGCTGCAGAAGGGCTAAGG + Intergenic
1056080738 9:83091890-83091912 ACTGAGCTGGGGAGGGAGATGGG + Intergenic
1056752455 9:89362474-89362496 ACTGGGCTGCAGAGCAGGAAAGG - Intronic
1056796295 9:89660949-89660971 GGTGACCTCCAGAGGGAGAAGGG + Intergenic
1058489030 9:105475341-105475363 TCACAGCTGAAGAGGGAGAATGG + Intronic
1058611076 9:106776240-106776262 ACTGAGATGCATGGAGAGAAGGG - Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1059408389 9:114116560-114116582 ACAGAGCTGCAGAGGATGGATGG - Intergenic
1059419883 9:114184242-114184264 ACCCAGCTGCAGAGGTTGAATGG + Intronic
1060497444 9:124129005-124129027 ACTGAGGTCCGGAGAGAGAAAGG + Intergenic
1060737234 9:126073758-126073780 ACTGAGGACCAGAGGGAGAAGGG + Intergenic
1060907773 9:127323406-127323428 ACTCAGCTGTAGAGGCAGGAGGG - Intronic
1060987098 9:127825961-127825983 ACGGTGCTGCAGAGGGGGAGAGG + Intronic
1061621729 9:131814935-131814957 ACTGGGCCCCAGAGGGATAAAGG - Intergenic
1061804532 9:133130764-133130786 ACTGAGCCCCAGAGAGAGCAGGG + Intronic
1062192941 9:135257046-135257068 ACAGAGATAGAGAGGGAGAAAGG - Intergenic
1062528377 9:136987877-136987899 ACTGAGTGGCACTGGGAGAAGGG - Intergenic
1202796143 9_KI270719v1_random:121758-121780 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1186264618 X:7818724-7818746 AGTGAGGAGGAGAGGGAGAAGGG + Intergenic
1186374142 X:8980556-8980578 ACTGAGGTGCAGCCGGAGACTGG - Intergenic
1186402802 X:9275035-9275057 AGAGAGCTGGAGAGAGAGAAGGG + Intergenic
1186792703 X:13014429-13014451 ACTTATCTGCAGAAGGATAAGGG - Intergenic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1188993322 X:36851370-36851392 ACTGAGATGCAGAAGAATAAAGG - Intergenic
1189230255 X:39446511-39446533 ACTGAGATGGAGAGGATGAACGG - Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190282447 X:48939988-48940010 ACACAGCTGCAGAGGGAGACAGG + Intronic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1194182617 X:90732794-90732816 ATAGACATGCAGAGGGAGAATGG - Intergenic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1195532633 X:105973788-105973810 AGTGAGATGGAGAGGAAGAAAGG - Intergenic
1198393377 X:136198869-136198891 ACTGAGCAGCAGCTGGTGAAGGG - Intronic
1198862351 X:141084458-141084480 ACTTAGCTGCACAGGAACAATGG - Intergenic
1198900343 X:141502928-141502950 ACTTAGCTGCACAGGAACAATGG + Intergenic
1198971935 X:142291766-142291788 ACAGAGCCGCAGAGAGAGATTGG - Intergenic
1199605357 X:149573908-149573930 AGTGAGGACCAGAGGGAGAAAGG - Intergenic
1199633764 X:149795460-149795482 AGTGAGGACCAGAGGGAGAAAGG + Intergenic
1200239720 X:154487093-154487115 ACTGAGCTTGAGAGGGGGCAGGG + Intergenic
1200529242 Y:4314747-4314769 ATAGACATGCAGAGGGAGAATGG - Intergenic
1201167000 Y:11217749-11217771 ACTCAGCTGAGGTGGGAGAATGG + Intergenic
1201596949 Y:15680764-15680786 AGAGAGCTGCAGAGGGACAGTGG + Intergenic