ID: 1162184757

View in Genome Browser
Species Human (GRCh38)
Location 19:8896048-8896070
Sequence ATGGTGAAGTTGAGTGTGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 6, 2: 1, 3: 24, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162184751_1162184757 16 Left 1162184751 19:8896009-8896031 CCAGGGTGACCCATGTTCTCCTC 0: 1
1: 0
2: 2
3: 17
4: 180
Right 1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG 0: 1
1: 6
2: 1
3: 24
4: 289
1162184752_1162184757 7 Left 1162184752 19:8896018-8896040 CCCATGTTCTCCTCATACTGTAG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG 0: 1
1: 6
2: 1
3: 24
4: 289
1162184755_1162184757 -3 Left 1162184755 19:8896028-8896050 CCTCATACTGTAGGTTAGTGATG 0: 1
1: 1
2: 3
3: 14
4: 87
Right 1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG 0: 1
1: 6
2: 1
3: 24
4: 289
1162184753_1162184757 6 Left 1162184753 19:8896019-8896041 CCATGTTCTCCTCATACTGTAGG 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG 0: 1
1: 6
2: 1
3: 24
4: 289
1162184750_1162184757 23 Left 1162184750 19:8896002-8896024 CCTGGAGCCAGGGTGACCCATGT 0: 2
1: 1
2: 4
3: 28
4: 203
Right 1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG 0: 1
1: 6
2: 1
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162184757 Original CRISPR ATGGTGAAGTTGAGTGTGAA TGG Exonic
900169843 1:1261512-1261534 CTGGTGAAGTTGAGGGAGACTGG + Intronic
900715657 1:4141839-4141861 ATGGTGGAGTGGAGGGTGGACGG + Intergenic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902679854 1:18035584-18035606 AGGGTGAAGTTGTGTGTCTAGGG - Intergenic
903780316 1:25816366-25816388 CTGGGGAAGTTTACTGTGAAGGG + Exonic
904326976 1:29732901-29732923 ATGATGGAGATGAGTGTCAATGG + Intergenic
904389955 1:30177162-30177184 ATTTGGAAGTTGAGTGTTAAAGG + Intergenic
904969542 1:34408370-34408392 ATGGCAAAGTTTAGCGTGAAGGG + Intergenic
905320056 1:37109633-37109655 ATGGTAAAGTTGTGTCAGAATGG + Intergenic
906186703 1:43867565-43867587 GTGGTGAAGTTGTGTGGGGAAGG + Intronic
908789828 1:67770457-67770479 ATGGTGGAGGGGAGGGTGAAAGG + Intronic
909154670 1:72058146-72058168 ATGGTGAAGTTTCATGTGAAGGG - Intronic
909916090 1:81321432-81321454 ATGATGAAGCTTAGTGAGAAAGG - Intronic
910054855 1:83021282-83021304 ATGATGAAGCTTAGTGAGAAAGG - Intergenic
910352122 1:86309770-86309792 AGGGTGAAGTTGGGAGTAAAGGG - Intergenic
911041730 1:93596542-93596564 AAGTTGACATTGAGTGTGAATGG + Intronic
911146408 1:94556274-94556296 TTGGTGAGGTTCAGTGGGAAGGG + Intergenic
911207956 1:95111683-95111705 ATGGTGCAGTGGACTGTGGAAGG + Intergenic
912638441 1:111320641-111320663 GTGGTGGAGTAGAGTGTGAGAGG + Intergenic
914337043 1:146724849-146724871 ATGGTAAAAATAAGTGTGAAAGG + Intergenic
915951431 1:160192166-160192188 AGGCTGAAGTAGAGTGCGAAAGG + Intronic
917630535 1:176887261-176887283 ATGGGGTAGTTGAGTGTGTGGGG - Intronic
918645114 1:186895026-186895048 ATGGAGAAGCTGAGAGTTAAGGG - Intronic
918765024 1:188470417-188470439 TTTATGAAGTTGAGTTTGAAAGG - Intergenic
921052858 1:211523534-211523556 AGGGTGAAGAGGAGTGTGAGTGG - Intergenic
921747970 1:218759284-218759306 ATGGGGTAGTTAAGAGTGAAGGG - Intergenic
922032482 1:221815019-221815041 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
922198190 1:223377874-223377896 ATGGGGAAGTTGAGGATGAGTGG + Intergenic
1063939673 10:11114629-11114651 ATGGTGAATTTGAGAATGAAAGG + Intronic
1064200248 10:13278406-13278428 ATGGTGAAATTGAAGGTTAATGG - Intronic
1064780590 10:18833670-18833692 AATGTGAAGATAAGTGTGAATGG + Intergenic
1068860919 10:61846885-61846907 AGGGTGAAGGTGGGTATGAAAGG - Intergenic
1069067261 10:63955657-63955679 ATGTTTAAGTTTAGTGAGAAAGG - Intergenic
1071864174 10:89707655-89707677 CTGGTGTAATTGGGTGTGAAGGG - Intronic
1073282724 10:102366504-102366526 ATGGTGAGTTTGAGTGTCAGGGG + Exonic
1074075712 10:110122246-110122268 TTGGCGAAATTGAGTTTGAAGGG + Exonic
1074451052 10:113559961-113559983 ATGGTGAAGTGGCTTGTGTAAGG - Intronic
1075191963 10:120317399-120317421 GTGGAAAAGTTGAGGGTGAAGGG - Intergenic
1075261734 10:120969297-120969319 ATGGAGGAGTTGAGTGGGAGCGG + Intergenic
1075595790 10:123728140-123728162 AGGATGAAGTTCACTGTGAATGG - Intronic
1078622005 11:12916873-12916895 ATGGTGAAGTTAAGGAGGAAAGG + Intronic
1079204252 11:18400217-18400239 CTGGTGCTGTTAAGTGTGAAAGG - Intronic
1079955452 11:26857535-26857557 ATGGTAAAGTAGAGTGAAAAAGG + Intergenic
1080239309 11:30108330-30108352 ATGGTTAAGTAGATTGTGAAAGG - Intergenic
1080453298 11:32396535-32396557 ATGGGGATCTGGAGTGTGAATGG - Intronic
1080512818 11:32991727-32991749 ATGTTAAACTTGAGTGTTAAAGG - Intronic
1081366256 11:42239014-42239036 AAGGTGAATTTGAGTGTGGAAGG + Intergenic
1082044074 11:47710744-47710766 CTGGTGTAGTGGAGTGAGAAAGG + Intronic
1084849882 11:71930080-71930102 AAGGAGATGTTGAGTGTGAAAGG + Intronic
1085024723 11:73229783-73229805 ATGTTTATGTTGACTGTGAAGGG + Intronic
1088783830 11:113162984-113163006 TAGGGGAATTTGAGTGTGAAGGG - Intronic
1088816079 11:113421927-113421949 AAGGTGAAGCTGAGTGTGTCAGG - Intronic
1089061461 11:115629499-115629521 ATGGAGAAATTGGGTGGGAAGGG - Intergenic
1089453651 11:118613329-118613351 ATGGTGAAGAGGAGAATGAAAGG + Exonic
1089472811 11:118734444-118734466 ATGGAGATGCTGAGTGGGAAAGG + Intergenic
1090237696 11:125161490-125161512 ATAATTAAGTTGAGAGTGAAGGG + Intergenic
1090898250 11:131000215-131000237 ATGGTTAAGTTAAAAGTGAAAGG - Intergenic
1091192956 11:133709349-133709371 ATGCTGAGGGTGAGGGTGAAGGG - Intergenic
1092217746 12:6694767-6694789 AAGGTGGAGGTGAGTGTGCAAGG + Exonic
1092218272 12:6697273-6697295 GTGGGGAAGGTGAGTGGGAAAGG - Exonic
1095764153 12:45876057-45876079 ATGATTAAGTTTAGTGAGAAAGG - Intronic
1095937714 12:47704016-47704038 ATGCTGAATTTGAGTGCTAATGG + Intronic
1096590614 12:52656668-52656690 ATGGAGAAGTTGGGTAAGAAGGG - Intergenic
1096596337 12:52698175-52698197 ATGGATAAATTGAGTGTGGAGGG - Intronic
1097735206 12:63174951-63174973 ATAGTGAAGCTGAGTGTTACTGG - Intergenic
1098136838 12:67412152-67412174 TTAGTGAAGATGAGTTTGAAGGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099520988 12:83662276-83662298 ATAGTGTAGATGAGTCTGAAAGG - Intergenic
1100718488 12:97330264-97330286 ATGGTGAAGTTAATTGAGAGAGG + Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102974112 12:117193813-117193835 CTGGATAAGTTGAGTTTGAAGGG - Intergenic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1104120209 12:125791575-125791597 ATGGTCCAGTGGGGTGTGAAGGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104998304 12:132672914-132672936 AAGCTGAACTTCAGTGTGAAAGG + Intronic
1105249008 13:18679274-18679296 ATGAAGAAAGTGAGTGTGAATGG + Intergenic
1105485031 13:20819945-20819967 GTGGTGAAGTTGAGGGCTAATGG - Intronic
1106459493 13:29956443-29956465 TTGGTCAAGTCAAGTGTGAATGG - Intergenic
1108678876 13:52762447-52762469 ATGGTGAAGTTGGGGGAGGAAGG + Intergenic
1111078780 13:83275313-83275335 GAGGAGTAGTTGAGTGTGAAAGG - Intergenic
1111255733 13:85665462-85665484 GTGGAGAACTTGAGAGTGAAAGG - Intergenic
1111470308 13:88672636-88672658 ATGCTGAAGTTGAGGAGGAAAGG - Intergenic
1112653418 13:101422870-101422892 ATGATTAAGTTTAGTGAGAAAGG - Intergenic
1112978919 13:105356943-105356965 ATGATTAAGTTTAGTGTGGAAGG + Intergenic
1113219169 13:108078889-108078911 ATGATGCAGATGACTGTGAAAGG - Intergenic
1115734504 14:36309946-36309968 ATAGTGAAGTAGAGTTTTAAAGG - Intronic
1116738240 14:48721868-48721890 ATGGGTAAATTGAGTGTCAAGGG - Intergenic
1116923716 14:50610541-50610563 ATGGAGAAGTTGACAGTGAAAGG + Intronic
1117749032 14:58901540-58901562 AAGGGGAAGTTGAGGTTGAAGGG + Intergenic
1120623775 14:86798794-86798816 TTTGTAAAGTTGAGTGGGAAAGG - Intergenic
1121501639 14:94442772-94442794 ATGGTGGACATGAGTGAGAAGGG - Exonic
1121608420 14:95258551-95258573 GTGGTGTGGTTGTGTGTGAAGGG + Intronic
1123160011 14:106268978-106269000 ATAGAAAAATTGAGTGTGAATGG - Intergenic
1125413427 15:39428567-39428589 ATGGTGAAGTGGAATGATAATGG - Intergenic
1128138172 15:65279445-65279467 ATGGTGATATGGAGGGTGAAGGG - Intronic
1128769467 15:70271059-70271081 ATGGTGAAATGGCCTGTGAAAGG + Intergenic
1129048127 15:72755285-72755307 ATGGAAAAGTTGAAAGTGAATGG - Intronic
1133313679 16:4868499-4868521 ATGGTGTAGTTGATGGTGTATGG + Intronic
1133708482 16:8378578-8378600 ATGGGGGAGGTGAGAGTGAAAGG + Intergenic
1133919102 16:10136117-10136139 ATGGTGGAGCAGAGTGTAAAAGG - Intronic
1134239387 16:12494234-12494256 ATGGTGGGGTCTAGTGTGAATGG - Intronic
1135363785 16:21835939-21835961 AGGGTGGAGCTGAGTGTGGAAGG + Intronic
1135633553 16:24055184-24055206 GTGGAGAAGATGATTGTGAAAGG - Intronic
1135969799 16:27063940-27063962 ATGGTGATGATGACTGTCAAGGG + Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137260053 16:46819213-46819235 ATGGTGATGTTAACTGTGGAGGG - Intronic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138520056 16:57565935-57565957 ATGGTGAAATTTAGAGTGCAGGG - Intronic
1139997227 16:70992470-70992492 ATGGTAAAAATAAGTGTGAAAGG - Intronic
1141028858 16:80570881-80570903 AGGGTGGGGTTGAGTGTGGAGGG - Intergenic
1141313208 16:82935210-82935232 ATGGAGAAGTGCAGAGTGAAGGG + Intronic
1144775538 17:17782980-17783002 TTGGTCAAGTGGAGTGTGCAAGG + Intronic
1145178345 17:20721669-20721691 ATTTTAAAGTTGAGTGTGGATGG + Intergenic
1146024815 17:29310650-29310672 ATGGTGAAGATCAGAGAGAAAGG - Intergenic
1147256656 17:39185770-39185792 AGGGTGGAGTTGTGTGTGGAGGG + Intronic
1147798492 17:43063929-43063951 ATGCTGAGTTTGTGTGTGAACGG - Exonic
1147955731 17:44133251-44133273 AAGGTGAAGTTGAGAAGGAAGGG + Intergenic
1148387386 17:47244201-47244223 ATGGTGTGGTTGAGAGGGAAGGG + Intergenic
1150446109 17:65228057-65228079 AAGTTGAAGTTGAGTGTTGAGGG + Intergenic
1150701274 17:67448701-67448723 ATGGTGATTTTGACTGTGGAAGG - Intronic
1150973672 17:70059427-70059449 ATGGTGAAGATGAGACTTAAAGG + Intronic
1151343631 17:73487661-73487683 ATGGTAAAGTTGTGTGTGCAAGG - Intronic
1153632983 18:7089533-7089555 ATTGTGAAGGTGAGTGGGAGGGG + Intronic
1154291828 18:13115405-13115427 CAGGAGAAGTTCAGTGTGAAAGG + Intronic
1154439873 18:14379955-14379977 ATGAAGAAAGTGAGTGTGAATGG - Intergenic
1158140951 18:54255100-54255122 ATGGTGAAATAGATTGTGCAGGG - Intergenic
1158496709 18:57961612-57961634 GTGGTGAAGTCAACTGTGAAAGG + Intergenic
1158746781 18:60209103-60209125 AAGTTGAAGTTGAGTGTTGAAGG - Intergenic
1158984088 18:62795775-62795797 AAGGTGAAATTGAGTGGGAAGGG - Intronic
1160029678 18:75248328-75248350 ATGATGAAGTTGCCTGTGGAAGG + Intronic
1160283207 18:77512687-77512709 AAGGTGTACTTGACTGTGAAAGG - Intergenic
1160393745 18:78557384-78557406 ATGATGTTGTTGAGAGTGAAAGG + Intergenic
1162182052 19:8876616-8876638 ATGGTGAAGTTCAGTGTGAATGG + Exonic
1162184355 19:8892972-8892994 ATGGTAAAATTGAGGGTGAATGG + Exonic
1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG + Exonic
1162185171 19:8898994-8899016 ATGGTAAAGTTGAGGGTGAACGG + Exonic
1162185596 19:8902180-8902202 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162185974 19:8905027-8905049 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162186700 19:8910460-8910482 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162187310 19:8915597-8915619 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162188151 19:8923016-8923038 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1165017741 19:32894702-32894724 TTGGTGAGGTCAAGTGTGAAAGG - Intronic
925369778 2:3336116-3336138 AGGGTGAAGGGGAGGGTGAAGGG + Intronic
925933778 2:8733508-8733530 AAGCTGAAGTTGAGTGTGTAGGG + Exonic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
926786704 2:16525203-16525225 ATGGGGAAATTGAGGGTCAAAGG - Intergenic
927897054 2:26789634-26789656 ATGGGGAAGCTGAGGATGAAGGG - Intronic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928144668 2:28761883-28761905 ATGGAGAATTTGAGTGTAAGAGG - Intronic
928339306 2:30427691-30427713 ATGGTGAAGTCCAGTGTGACAGG - Intergenic
928586672 2:32766132-32766154 ATGATTAAGTTTAGTGAGAAAGG - Intronic
930968011 2:57355734-57355756 AGAGTGATGTTAAGTGTGAAAGG + Intergenic
931100065 2:58988439-58988461 ATGGAGAACTTAAGAGTGAAGGG - Intergenic
932288036 2:70553458-70553480 AAGGGGAAGCGGAGTGTGAACGG - Intronic
933091145 2:78119030-78119052 ATGGTCTACTTGAGAGTGAAGGG - Intergenic
933170077 2:79115231-79115253 ATAGTGATGATGGGTGTGAAGGG - Intergenic
933821459 2:86115873-86115895 TTGGTGAAGTTGAGCGTGGGTGG + Intronic
935712501 2:105911835-105911857 CTGGGGAAGTTGTGTGTGATGGG + Intergenic
935898327 2:107762157-107762179 ATGGTTAAGATGATTGTTAAGGG + Intergenic
936906572 2:117542292-117542314 TTGGTTAAATTGTGTGTGAAAGG - Intergenic
936963815 2:118105705-118105727 ATGGTGAAAAAGAGTGTTAAAGG + Intronic
937156029 2:119719696-119719718 AAGGTGAAATGGAGTGGGAATGG + Intergenic
939267057 2:139887835-139887857 TGGGAGAAGTTGAGTGTGATAGG + Intergenic
939934152 2:148268816-148268838 ATGATGAAGTAGAGTTTAAATGG - Intronic
943417337 2:187624814-187624836 ATGGTGAACTGAAGTTTGAAAGG - Intergenic
943957341 2:194209081-194209103 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
944372041 2:198995912-198995934 ATAGTGAGGTTGAGTATGGAAGG - Intergenic
944584017 2:201157833-201157855 GTGGTGAGGTGGAGTGGGAAGGG - Intronic
945586025 2:211664061-211664083 AAGGTGAATTTGAATTTGAATGG + Intronic
948262526 2:236614759-236614781 ATGGGGGAATTGAGTGTGTAAGG + Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169412966 20:5389660-5389682 AAGGTGAAGTTAAGAGTAAAAGG + Intergenic
1169726369 20:8737655-8737677 AGGGCCCAGTTGAGTGTGAAAGG - Intronic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1172916089 20:38444825-38444847 ATTGAGAGCTTGAGTGTGAAAGG + Intergenic
1173860062 20:46277565-46277587 ATGGTGAAGGTGAGTGAAAAGGG + Intronic
1175461716 20:59156646-59156668 ATGGGGAAGGTGAGGGTCAAAGG - Intergenic
1175559215 20:59904982-59905004 ATGTTGGTGTTGAGGGTGAAGGG - Intronic
1176455872 21:6909816-6909838 ATGAAGAAAGTGAGTGTGAATGG + Intergenic
1176834046 21:13774864-13774886 ATGAAGAAAGTGAGTGTGAATGG + Intergenic
1177513219 21:22117040-22117062 ATGTTGAAGTTGAGTGAGTGGGG + Intergenic
1177638188 21:23812679-23812701 ATGATGTAATTGAGAGTGAAAGG + Intergenic
1179523488 21:41960444-41960466 ATGTAGAAGTTGAGTTTGTAAGG + Intergenic
1180935506 22:19622621-19622643 CAGGTGAACTTGAGGGTGAAGGG - Intergenic
1183449992 22:37888201-37888223 ATGGGTTTGTTGAGTGTGAAGGG + Intronic
949826719 3:8173255-8173277 ATGATGAAGGTGAGTTTGAAGGG + Intergenic
950326435 3:12114658-12114680 ATGGTGAAGTTGAGAGTTGAAGG - Intronic
951862405 3:27267827-27267849 ATGATGAAGCTTAGTGAGAAAGG + Intronic
952257939 3:31711558-31711580 ATGGGAAACTTGAGTGTGCAAGG + Intronic
952603330 3:35111657-35111679 ATGGTGAAGTCGAGGCTAAAAGG + Intergenic
952838817 3:37627345-37627367 ATGATGAAGTGGAGTGGCAAGGG - Intronic
953633562 3:44642017-44642039 ATTTTGAAGAAGAGTGTGAATGG + Exonic
953958524 3:47249071-47249093 TTGGTGAGGATGAGGGTGAAAGG - Intronic
956145083 3:66184006-66184028 AGGTTCAAGGTGAGTGTGAAAGG - Intronic
956536371 3:70281332-70281354 ATAATGAAGTTGAGAGAGAATGG - Intergenic
957796049 3:85009122-85009144 CTGGGGAAGTTGAGAATGAATGG + Intronic
958907296 3:99956203-99956225 AAGGTGAAGGTGTTTGTGAAGGG - Intronic
959390342 3:105764676-105764698 ATGATTAAGTTTAGTGAGAAAGG + Intronic
959864805 3:111253731-111253753 ATGGGTAAGTTGTGTGTGGAGGG + Intronic
959899809 3:111648046-111648068 AGTGTGAAATTGAGTGAGAAAGG + Intronic
960548319 3:118943822-118943844 GTGGTGAAGTTGAGAGTACATGG - Intronic
960926110 3:122795898-122795920 ATGGGGATGTTGAGGATGAAAGG + Intronic
964382790 3:156114588-156114610 ATGCTGAAGGTGTGTGTGAGAGG + Intronic
964711638 3:159677326-159677348 CTGTTGATGTTGAGTATGAATGG + Intronic
965117424 3:164510120-164510142 ATTGTGAAGTTCAGAGTAAAAGG - Intergenic
965438695 3:168685872-168685894 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
966638333 3:182160301-182160323 AGGGTGAAGTAGGGAGTGAAAGG - Intergenic
966955471 3:184873330-184873352 AGGGAGAAGATGAGTGAGAAGGG + Intronic
967325816 3:188238454-188238476 ATGGTTAAGTTTAGTGAGGAAGG - Intronic
967665599 3:192168091-192168113 AGGGTGAAGTTGAATATAAAGGG + Intronic
968153616 3:196359474-196359496 ATGATGAAGCTTAGTGAGAAAGG + Intronic
969165470 4:5306628-5306650 ATGCTAATGTTGAATGTGAATGG - Intronic
969208842 4:5670885-5670907 ATGGTGAAGATGATGGTGATGGG - Intronic
973775523 4:54237894-54237916 ATGGTGAAGTGGAGAGGGCATGG + Intronic
973961625 4:56116453-56116475 ATGGTGCAGTACAGAGTGAAAGG - Intergenic
975613922 4:76228017-76228039 ATACTGAAGTTGAATGTAAATGG - Intronic
977249340 4:94672094-94672116 ATGGTTTAGTTTATTGTGAAGGG - Intergenic
977719840 4:100226501-100226523 TAGGGGAAGTTGAGTGTAAAGGG + Intergenic
978495539 4:109355865-109355887 ATGATGAAATTGAGACTGAAAGG - Intergenic
980489269 4:133504952-133504974 TAGGTGATGGTGAGTGTGAAAGG + Intergenic
980562784 4:134499976-134499998 ATGTGGAAGTTGAGTGTCAGAGG - Intergenic
980774312 4:137419730-137419752 ATGAGGAAATTGAGTATGAAAGG + Intergenic
981077492 4:140605744-140605766 ATGGAGAAGTTAACTCTGAATGG - Intergenic
982021731 4:151211487-151211509 ATGGTTAAGTTTAGTGAGGAAGG + Intronic
982501545 4:156162938-156162960 ATGATGAAGTTGAATGTAAGGGG + Intergenic
983275810 4:165616045-165616067 ATGTTCAAGTTGGGTGTGAGAGG - Intergenic
985564987 5:611284-611306 ATGGTGTAGGGGAGTGTGTAGGG - Intergenic
985630616 5:1012108-1012130 ATGGTGAGGGTGAGTGTGCAGGG - Intronic
985637568 5:1045898-1045920 ATTGTGTGGATGAGTGTGAATGG + Intergenic
987720110 5:21622517-21622539 GTGGTGAATTTGAGGGTTAAGGG + Intergenic
989135336 5:38148559-38148581 ATGTTGAAGGAGAGAGTGAATGG + Intergenic
990097732 5:52138138-52138160 ATGGTGAGCTTGAGTGGGACGGG + Intergenic
990263850 5:54054904-54054926 ATGGAGAAGTTTGGTGTGACTGG - Intronic
991144657 5:63286130-63286152 AGGGTAGAGGTGAGTGTGAAAGG + Intergenic
994025182 5:95073649-95073671 AAGGTAAAGTTGAGAGGGAAGGG + Intronic
998994379 5:147854512-147854534 CTGGTGAAGGTGAGTGTGTGGGG - Intergenic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
999511883 5:152260756-152260778 ATGGGGAATGTGAGTGAGAATGG + Intergenic
1000422329 5:161053051-161053073 ATGTTGATGTTGAGAGAGAATGG + Intergenic
1001295605 5:170496763-170496785 GTGGTGAGGTTGAGGGTGGACGG - Intronic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1006800727 6:36758039-36758061 CTGGTGGAGGTGAGTGTGAGGGG + Intronic
1008812556 6:55521847-55521869 ATGATTAAGTTTAGTGAGAAAGG + Intronic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1009469401 6:64013482-64013504 ATGTTGATGATGAGTGTCAATGG + Intronic
1009864668 6:69382092-69382114 ATGGTGAAGTTGAGAGAAAAGGG + Intronic
1011060697 6:83263371-83263393 ATGGTTAAGTTTAGTGAGAAAGG + Intronic
1011848834 6:91600961-91600983 AAGGTTAATTTGATTGTGAATGG + Intergenic
1014590607 6:123263031-123263053 ATGATTAAGTTTAGTGAGAAAGG + Intronic
1014726920 6:124982232-124982254 AAGATGAATATGAGTGTGAAAGG - Intronic
1017013808 6:150083888-150083910 ATGTAAAAGTGGAGTGTGAAGGG + Intergenic
1017366144 6:153641979-153642001 ATAGTGAAGTTGGAGGTGAAAGG - Intergenic
1017788348 6:157774454-157774476 AAGGTGAAGTGGAGGGTGAGGGG + Intronic
1018843619 6:167538163-167538185 ATGATTAAGCTTAGTGTGAAAGG - Intergenic
1022317876 7:29262768-29262790 ATGGTGAAGATGGGGGTGCAGGG + Intronic
1023145958 7:37151321-37151343 ACTGTGAAGTGTAGTGTGAACGG - Intronic
1023694698 7:42832916-42832938 ATGGAGAAGGTGAATATGAAAGG + Intergenic
1023710251 7:42985077-42985099 ATGATGAAGTTTAGTGAGAAAGG - Intergenic
1024460611 7:49655917-49655939 ATGGTGAGGCTGAGGGAGAAGGG + Intergenic
1024788308 7:52933763-52933785 ATGGTGAAGTGGGATGTGAATGG + Intergenic
1028887750 7:95953157-95953179 AGTGTGAAGGTGTGTGTGAAGGG - Intronic
1031755019 7:125628194-125628216 ATGTAGAACTTAAGTGTGAAAGG + Intergenic
1033134951 7:138776553-138776575 AGGGTGAAGTGGAGAGTGGAGGG - Intronic
1033215122 7:139487739-139487761 AAGGTGAAGGTGAAGGTGAAGGG + Intergenic
1036723103 8:11196286-11196308 ATGTTTATGTTGCGTGTGAAAGG - Intronic
1036728418 8:11240740-11240762 ATTTTTAAGTTGAGTGTGAATGG + Intergenic
1037610108 8:20468935-20468957 ATGGAGAGGCTGAGTGTAAAAGG - Intergenic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038650347 8:29397241-29397263 ATGATGAAGTTGAGTATTGAAGG - Intergenic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039444494 8:37620241-37620263 GTCGTGAAGTTGAATATGAATGG + Intergenic
1043925148 8:86028218-86028240 AGAGAGACGTTGAGTGTGAAGGG - Intronic
1044893573 8:96863507-96863529 GTGGTGAAGGTGAGGGTAAAGGG + Intronic
1045944259 8:107777621-107777643 ATGGGGAAGTTGAGGGAAAATGG - Intergenic
1047220448 8:122914356-122914378 ATGGTGAAGTGGGGGGAGAAAGG + Intronic
1047819654 8:128504622-128504644 GAGGTGAAGTCGAGAGTGAATGG - Intergenic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1049974949 9:852711-852733 AGGGTGAATGTGAGTGTGGATGG - Intronic
1050036431 9:1440567-1440589 AGGGTGAAGTTCAGTGAGGATGG - Intergenic
1050468377 9:5957919-5957941 ATGATCAAGTTGAGTGATAAGGG - Intronic
1050824406 9:9927375-9927397 ATGGTGAATTTGAATGTAGAGGG - Intronic
1052358080 9:27527049-27527071 ATGGTGAAAATGAATGTAAAAGG - Intronic
1053498059 9:38563017-38563039 ATGGTGGGGTTGGGGGTGAAAGG - Intronic
1055212307 9:73811535-73811557 ATGGTTAAATAGAGTTTGAATGG + Intergenic
1056099540 9:83287578-83287600 ATGGTGAAGGTGAGGTAGAAAGG - Intronic
1056586420 9:87930454-87930476 ATGGTGGGGTTGGGGGTGAAAGG - Intergenic
1056610459 9:88122488-88122510 ATGGTGGGGTTGGGGGTGAAAGG + Intergenic
1058015315 9:100025161-100025183 CTGGTGAAGATGTGTGGGAATGG - Intronic
1058346958 9:103975767-103975789 ATGCTCAAGTTGAGTCTTAAAGG - Intergenic
1059162270 9:112046433-112046455 ATGGTGAAGTTTAGTCTTAATGG - Intronic
1060059550 9:120446819-120446841 ATGGTGAAGTGGCATTTGAAGGG - Intronic
1060122378 9:121005541-121005563 AAAGTGAAGATGAGTATGAATGG + Intronic
1060704673 9:125787367-125787389 GTGATGAAGTAGAGTTTGAAGGG + Intronic
1061590654 9:131595500-131595522 ATGGTGAAGTAAATTGTGGAGGG - Intronic
1185884706 X:3772103-3772125 ATGGTGAAGCAAAGTGTTAATGG + Intergenic
1186128530 X:6442210-6442232 GTGGTGAAATTAAGTGTGATTGG - Intergenic
1186148775 X:6652082-6652104 ATGGTGGAGTTAAGCTTGAAGGG + Intergenic
1186497657 X:10024714-10024736 ATGTTGATGTTGAGAATGAACGG + Intronic
1187082525 X:16006373-16006395 GTGGAGAAGTGGAGTGTGACTGG + Intergenic
1188267274 X:28093104-28093126 ATAGGGACGTAGAGTGTGAAGGG + Intergenic
1188368643 X:29341535-29341557 ATGAAAAAGTTGAGTCTGAAGGG + Intronic
1188550357 X:31357680-31357702 GTGGTCAAATTGACTGTGAAGGG - Intronic
1189572750 X:42316641-42316663 ATGGTGTAAGTGAGTGTGAAGGG + Intergenic
1190324652 X:49199389-49199411 ATGGTGAAGGTGAGTCATAACGG + Intronic
1192301909 X:69913739-69913761 ATCGTTAAGTTTAGTGAGAAAGG - Intronic
1192793656 X:74408949-74408971 AGGGTGAATTTGACTGAGAAGGG + Intergenic
1194180050 X:90699797-90699819 ATGGTAACCTTGAGTGTTAATGG + Intergenic
1197979042 X:132196477-132196499 ATGGGGTAGTTGGGAGTGAAGGG - Intergenic
1198175028 X:134146502-134146524 TTGAAGAAGTTGACTGTGAAAGG - Intergenic
1198436474 X:136621618-136621640 ATGCTGAAGAGGAGTTTGAAAGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1199080440 X:143570678-143570700 ATGGTCAAATTGTGTGTGCAAGG + Intergenic
1199338635 X:146649272-146649294 CTGGTGAAGTTGTGTGGAAAAGG + Intergenic
1200526706 Y:4281965-4281987 ATGGTAACCTTGAGTGTTAATGG + Intergenic
1201109452 Y:10788588-10788610 ATGGTGAAGTCAAATTTGAACGG - Intergenic
1201791002 Y:17840343-17840365 AGGGTTAAGTTGAGGGTAAAAGG + Intergenic
1201810552 Y:18065646-18065668 AGGGTTAAGTTGAGGGTAAAAGG - Intergenic
1202352612 Y:24009992-24010014 AGGGTTAAGTTGAGGGTAAAAGG + Intergenic
1202518167 Y:25660123-25660145 AGGGTTAAGTTGAGGGTAAAAGG - Intergenic