ID: 1162191884

View in Genome Browser
Species Human (GRCh38)
Location 19:8953529-8953551
Sequence GCTCAAACTTGAAGATGAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162191884 Original CRISPR GCTCAAACTTGAAGATGAAC TGG Exonic
900685762 1:3946630-3946652 GCTCAACCCTGAGGATTAACTGG - Intergenic
908024526 1:59936589-59936611 GACCTAAATTGAAGATGAACAGG - Intergenic
909553431 1:76925394-76925416 ACTCAATCTTGAAGATGATAGGG + Intronic
911818131 1:102380932-102380954 GCTTAAAGTTGAAAATGAAGAGG - Intergenic
917690658 1:177464952-177464974 GCTCACACTGGCAGTTGAACTGG - Intergenic
920932529 1:210402035-210402057 GCTCCAACTTGAACATGTAAAGG - Intronic
921370094 1:214413568-214413590 GCTCACACTTGCAGATAAGCTGG + Intronic
924746884 1:246843794-246843816 GAACAAGCTTGAAGATGAACTGG - Exonic
1064680697 10:17808611-17808633 ACTTAAACTTGAAGAGGACCGGG + Intergenic
1065072007 10:22034883-22034905 GCTCAAACTCGGAGATGGATGGG - Intergenic
1065638552 10:27755562-27755584 GCCCACACATGAAGAAGAACAGG - Intergenic
1068062826 10:52090590-52090612 GTTCAAACTTTAAGGTGAAAGGG + Intronic
1068704538 10:60059367-60059389 GCTCAAGCTCGAAGAGTAACTGG - Exonic
1068724271 10:60283507-60283529 GCACAAAAATGAATATGAACAGG + Intronic
1070014343 10:72510936-72510958 GCTAAAATTTGAAAATGGACTGG - Intronic
1073725815 10:106229218-106229240 GCACCTACTTGAAGATGATCAGG - Intergenic
1074430980 10:113394440-113394462 TCTCAAACTTGAACATGCGCTGG + Intergenic
1074763841 10:116686471-116686493 GTTCAAACTTGAAAATAAACTGG + Intronic
1075110768 10:119580252-119580274 GCTCAAATTTGAAGATTAATAGG + Intronic
1077999392 11:7481389-7481411 GCTGAGACTTGAAGGTGAATAGG - Intergenic
1078087269 11:8241630-8241652 GCTGAAGCTTGAAGATGAGAAGG - Intronic
1081329461 11:41786639-41786661 GCTCAAATTTGCAGCTGCACTGG - Intergenic
1085307210 11:75493573-75493595 TCTCAAACTTGAAGAACAAAAGG + Intronic
1090606652 11:128428865-128428887 ACTCAAGCTTGAAGATGACCAGG - Intergenic
1092246603 12:6867595-6867617 GGGGAAACTGGAAGATGAACGGG + Exonic
1095939874 12:47719169-47719191 TCAGAAACTTGAAGATGAAATGG + Intronic
1098306677 12:69109399-69109421 TCTCCAAGTAGAAGATGAACGGG - Intergenic
1104282758 12:127392743-127392765 GCTCAACCTTGAGGAAGAGCTGG + Intergenic
1107666566 13:42696891-42696913 GCTTAGACTTGAAGGTGAAGGGG + Intergenic
1110607909 13:77454571-77454593 GCTTAAATTTGTAGATGACCAGG - Intergenic
1116689228 14:48082880-48082902 GCACAAAATTGAAGATAAGCTGG - Intergenic
1117522667 14:56566288-56566310 GCTGAGACTTGAAGTAGAACAGG - Intronic
1120003537 14:79330901-79330923 ACTCAAAGATGAAGATGAAGGGG - Intronic
1120186949 14:81403246-81403268 GCTAAGACTTGAAGGTGAGCAGG - Intronic
1121037726 14:90720203-90720225 GCAGAAACCTGAAGATGAATTGG - Intronic
1125225667 15:37392885-37392907 GCAAAAATTTGAAGAGGAACAGG - Intergenic
1125743208 15:41981939-41981961 TCTCAAACTTCAATATGCACAGG + Exonic
1125882006 15:43203234-43203256 GCTCAAAATTGGAGAAGAACAGG + Exonic
1127041506 15:54982082-54982104 TCTCAAACTTGAAGGTTAAATGG + Intergenic
1127183833 15:56456467-56456489 GCTCAAACAAGAAGAAAAACTGG - Exonic
1129018987 15:72497557-72497579 GCAAACACTTGAAGATGAAATGG + Intronic
1136506334 16:30706022-30706044 TCTCAAACTTGAGGAGGCACCGG - Intronic
1143572198 17:7766424-7766446 GCTCGATCTTGAAGATGCCCAGG - Exonic
1144588148 17:16501286-16501308 GCTCAAACTTGAGCATGCATCGG + Intergenic
1148129783 17:45255920-45255942 CCTCAAGCTTGAAGCTGAGCTGG - Exonic
1148247717 17:46045937-46045959 TCTCATACTTGAAGAAGGACAGG - Intronic
1151837487 17:76592646-76592668 GCTTAAATTTGAATATGAACCGG + Intergenic
1152256203 17:79241312-79241334 GCTCAAACTTAAAGCGAAACAGG - Intronic
1155110145 18:22706907-22706929 GCTGAACCTTAAAGATGAGCAGG + Intergenic
1156947241 18:42849614-42849636 TCTCAAACTTGAAGATAACGTGG - Intronic
1157736635 18:50055267-50055289 GCTCAGACTGGAGGATGAAACGG - Exonic
1162191069 19:8947409-8947431 GCTCAAATTTGGAGATGAACTGG + Exonic
1162191309 19:8949158-8949180 GCTCAAATTTGGGGGTGAACTGG + Exonic
1162191548 19:8950910-8950932 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162191664 19:8951792-8951814 GCTCAAATTTGAAGTGGAACTGG + Exonic
1162191884 19:8953529-8953551 GCTCAAACTTGAAGATGAACTGG + Exonic
1162192022 19:8954414-8954436 GCTCAAACTTGGAGGTGAACTGG + Exonic
1162192250 19:8956187-8956209 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162192834 19:8960582-8960604 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162193079 19:8962355-8962377 GCTCATACTTTGAGGTGAACTGG + Exonic
1163412354 19:17163098-17163120 GCTCCAGCTTGAAGATGTGCTGG - Exonic
1168701358 19:58441413-58441435 GCTCTATCTTGAAGATCCACTGG - Intergenic
926724760 2:15988697-15988719 GCACAAACTGGAAGATCAACAGG + Intergenic
927830702 2:26347163-26347185 GCTAAGATGTGAAGATGAACGGG - Intronic
928120531 2:28580803-28580825 GCTCAGGCTTGAAGATGAGGAGG + Intronic
930854613 2:56000324-56000346 TCTCAAACTTGAGCATGAATCGG + Intergenic
933080327 2:77977232-77977254 GCCCAAGCTTGACGAAGAACAGG - Intergenic
933578391 2:84096427-84096449 GCCCAAACAAGAAAATGAACTGG + Intergenic
936733494 2:115411397-115411419 GCTCAAAATTGTAGAACAACTGG + Intronic
937598437 2:123698465-123698487 GCTAATCCTAGAAGATGAACTGG - Intergenic
937990720 2:127660798-127660820 GGTCTAACTGGAAGATGAGCCGG - Intronic
938946465 2:136216786-136216808 TCTCAAACTTGAATGTGCACAGG + Intergenic
940667165 2:156622682-156622704 GCTTAAATTTGCAGATGAATAGG + Intergenic
940722419 2:157297046-157297068 GCTTAGACTTGAAGCTGAAGTGG + Intronic
944281103 2:197898621-197898643 GCACAAAGTTAAGGATGAACAGG - Intronic
1170877789 20:20267171-20267193 GCTCAGTCTTGAAGAGGGACAGG + Intronic
1173185939 20:40840352-40840374 GGTGAAACTTGAAGATAAATAGG + Intergenic
1182149990 22:28021161-28021183 GCTCAAGCCTGAAGATGACCAGG + Intronic
1183546673 22:38457868-38457890 GCACAAACTTGAAGATGGGATGG + Intergenic
949165361 3:934213-934235 GGTCATACTTGAAGATACACTGG - Intergenic
950018596 3:9770495-9770517 GCTCCATCTTGCAGAGGAACCGG - Intronic
950236665 3:11327737-11327759 TCTCAAACTTGAAGATGCTTGGG - Intronic
950350733 3:12349070-12349092 GCTTAAACTTGAAGGTCAATTGG - Intronic
950714101 3:14835682-14835704 GCAAAGACTTGAAGAAGAACAGG + Intronic
954380317 3:50215753-50215775 GCTCAGACTTGATGATGTACAGG - Exonic
955101169 3:55851508-55851530 CCACAAACTTGAAGATCACCAGG + Intronic
956520398 3:70097378-70097400 GCACAAAATTGTGGATGAACCGG + Intergenic
959303302 3:104629900-104629922 CCTCAAGCATGAAGGTGAACTGG - Intergenic
960604772 3:119494049-119494071 GCTGAAACTTGAAGCTAAATGGG - Exonic
964231088 3:154468834-154468856 GCTAAAACCTGAAGATAAATGGG - Intergenic
964496517 3:157296567-157296589 CTTCAAACTTGGAGATAAACAGG + Intronic
965435418 3:168644572-168644594 TATCAAACTTGAAGATGGATTGG + Intergenic
965935444 3:174104707-174104729 GTTCAATCTTGCAGATAAACAGG + Intronic
970848173 4:20568479-20568501 GCTCATAAATGAAGAGGAACTGG - Intronic
971774101 4:30938436-30938458 GAGCAAACTTTAGGATGAACTGG + Intronic
975551769 4:75620240-75620262 GCACAAAATTGAAGATAAGCAGG + Intronic
978105733 4:104899908-104899930 GTTTAAACATGAAGATGAACTGG - Intergenic
979190832 4:117856423-117856445 AATCAAACCTGTAGATGAACGGG + Intergenic
980510362 4:133777930-133777952 GCTCAAACTTAAATAAGAAGTGG + Intergenic
982118843 4:152119751-152119773 GGTCAAACTTGATGATGAAGAGG - Intergenic
984611252 4:181841483-181841505 TCTCAAACTTGATGATGTATGGG - Intergenic
987259710 5:16190763-16190785 CCTAAAACATGAAGCTGAACAGG - Intergenic
989274589 5:39572143-39572165 GATTAAACTTGAGAATGAACAGG - Intergenic
990833934 5:59993247-59993269 TCTCAAACTTTAATATGCACTGG - Intronic
997571511 5:134931588-134931610 GCTCAAACTTCCAGAGGAAGTGG + Intronic
1001806902 5:174594537-174594559 TCTCCAACTTGAATATGCACGGG + Intergenic
1002931654 6:1639135-1639157 GCTCAGGCTTGAAGAGGAGCAGG + Intronic
1003724501 6:8745248-8745270 TCTCAAACTTTAATATGCACGGG + Intergenic
1007922785 6:45625971-45625993 CTACAAACTTGAAGATTAACTGG - Intronic
1008623583 6:53295873-53295895 GATCTAACTTGAAGATCAAAAGG + Intronic
1009461999 6:63924692-63924714 ACTGAAACTTAAAGATGATCTGG - Intronic
1010903802 6:81460548-81460570 TCTCCAACTTGAATATGCACAGG + Intergenic
1018968586 6:168508702-168508724 GCTCAAACTGGAAGAGGGATTGG + Intronic
1019823336 7:3262701-3262723 CCTCCATCTTGAAGAGGAACTGG + Intergenic
1022017247 7:26361406-26361428 TCTCAAACTTGAAGGTTATCAGG - Intronic
1022430298 7:30312513-30312535 GCCCAGATTTGAAGATGAAGTGG - Intronic
1023680718 7:42684646-42684668 ACACAAATTTGAAGATGAAAGGG + Intergenic
1026970275 7:74463532-74463554 TCTCCCACTTAAAGATGAACAGG - Intronic
1027865138 7:83636852-83636874 GCTCAGTCTTGAACATGAACAGG - Intronic
1028775170 7:94667696-94667718 TGTTAAAATTGAAGATGAACAGG - Exonic
1030000725 7:105057890-105057912 GAGAAAATTTGAAGATGAACTGG - Intronic
1030735950 7:113048814-113048836 GCTCAAACATGAAGGTGAGTAGG + Intergenic
1032555822 7:132834031-132834053 GCTCTATCTTGAACCTGAACCGG - Intronic
1032716454 7:134512976-134512998 TCTCAAACATCAACATGAACAGG + Intergenic
1035723825 8:1812669-1812691 GCCCACACTGGAAGATGGACAGG + Intergenic
1035723841 8:1812722-1812744 GCCCACACTGGAAGATGGACAGG + Intergenic
1037406307 8:18546374-18546396 GCTCAAAATTGGACATGGACTGG - Intronic
1042078554 8:65023478-65023500 GCGCAAACTTGAAGTTACACAGG + Intergenic
1043441008 8:80277083-80277105 TCTCAAACTTTAATATGCACAGG - Intergenic
1045942952 8:107759834-107759856 GCTCAATTTAGAAAATGAACTGG - Intergenic
1046830680 8:118742499-118742521 GCTGAGAATTGAAGATGAAGAGG + Intergenic
1046962287 8:120124567-120124589 GCTCAAACTTTAAGGTGCAGGGG - Intronic
1048064742 8:130956436-130956458 CCTCAAATTTGAAGATGAGTAGG - Intronic
1048112627 8:131485296-131485318 GATCAAGCCTGAAGATGAATAGG - Intergenic
1058785355 9:108381467-108381489 GCTGGACCTTGAAGATGAAAAGG + Intergenic
1060159984 9:121353402-121353424 GCTCATTCACGAAGATGAACTGG - Intronic
1060270982 9:122141307-122141329 GAGCAAACTTGAGGATGGACTGG + Intergenic
1061642633 9:131971311-131971333 GCTCAAACTTGGAGATTTCCCGG + Intronic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1186693773 X:12007323-12007345 GCTCAATCTCCAAGGTGAACAGG - Intergenic
1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG + Exonic
1194769145 X:97879597-97879619 GCTGAGACTTGAAGATGACTAGG + Intergenic
1195068861 X:101260841-101260863 TCTCGAACTTGAAGATTAAAGGG - Exonic
1195156558 X:102128920-102128942 TCTCAAACTTTAAGGTGTACAGG - Intergenic
1198814772 X:140577878-140577900 GCGAAAATTTGAATATGAACTGG - Intergenic
1199778771 X:151038952-151038974 CCTCAAACTTCAGGGTGAACTGG - Intergenic
1201537660 Y:15068352-15068374 ACTCCATCTTGAAGAGGAACTGG + Intergenic