ID: 1162195892

View in Genome Browser
Species Human (GRCh38)
Location 19:8984417-8984439
Sequence AAGGGCCTATTGGAGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162195885_1162195892 9 Left 1162195885 19:8984385-8984407 CCTTTACTGTGCGGAAGCTCTTT No data
Right 1162195892 19:8984417-8984439 AAGGGCCTATTGGAGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162195892 Original CRISPR AAGGGCCTATTGGAGGGTGG AGG Intergenic
No off target data available for this crispr