ID: 1162198739

View in Genome Browser
Species Human (GRCh38)
Location 19:9006217-9006239
Sequence CTGTGATCAGTTTAGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162198737_1162198739 -8 Left 1162198737 19:9006202-9006224 CCTGCGGCTCTGGGACTGTGATC No data
Right 1162198739 19:9006217-9006239 CTGTGATCAGTTTAGGTCCCTGG No data
1162198733_1162198739 5 Left 1162198733 19:9006189-9006211 CCTGGCATTTGTCCCTGCGGCTC No data
Right 1162198739 19:9006217-9006239 CTGTGATCAGTTTAGGTCCCTGG No data
1162198728_1162198739 30 Left 1162198728 19:9006164-9006186 CCTACTGCGATCTGTGTCCTCCT No data
Right 1162198739 19:9006217-9006239 CTGTGATCAGTTTAGGTCCCTGG No data
1162198736_1162198739 -7 Left 1162198736 19:9006201-9006223 CCCTGCGGCTCTGGGACTGTGAT No data
Right 1162198739 19:9006217-9006239 CTGTGATCAGTTTAGGTCCCTGG No data
1162198730_1162198739 13 Left 1162198730 19:9006181-9006203 CCTCCTGACCTGGCATTTGTCCC No data
Right 1162198739 19:9006217-9006239 CTGTGATCAGTTTAGGTCCCTGG No data
1162198731_1162198739 10 Left 1162198731 19:9006184-9006206 CCTGACCTGGCATTTGTCCCTGC No data
Right 1162198739 19:9006217-9006239 CTGTGATCAGTTTAGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162198739 Original CRISPR CTGTGATCAGTTTAGGTCCC TGG Intergenic
No off target data available for this crispr