ID: 1162199416

View in Genome Browser
Species Human (GRCh38)
Location 19:9009888-9009910
Sequence AATGAGCAAGTCGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162199416_1162199421 8 Left 1162199416 19:9009888-9009910 CCTGCGGCGGCGACTTGCTCATT No data
Right 1162199421 19:9009919-9009941 TGAGAGCTGGGCACAGATACTGG No data
1162199416_1162199422 9 Left 1162199416 19:9009888-9009910 CCTGCGGCGGCGACTTGCTCATT No data
Right 1162199422 19:9009920-9009942 GAGAGCTGGGCACAGATACTGGG No data
1162199416_1162199423 14 Left 1162199416 19:9009888-9009910 CCTGCGGCGGCGACTTGCTCATT No data
Right 1162199423 19:9009925-9009947 CTGGGCACAGATACTGGGACTGG No data
1162199416_1162199417 -5 Left 1162199416 19:9009888-9009910 CCTGCGGCGGCGACTTGCTCATT No data
Right 1162199417 19:9009906-9009928 TCATTTCTGTCCCTGAGAGCTGG No data
1162199416_1162199424 17 Left 1162199416 19:9009888-9009910 CCTGCGGCGGCGACTTGCTCATT No data
Right 1162199424 19:9009928-9009950 GGCACAGATACTGGGACTGGAGG No data
1162199416_1162199418 -4 Left 1162199416 19:9009888-9009910 CCTGCGGCGGCGACTTGCTCATT No data
Right 1162199418 19:9009907-9009929 CATTTCTGTCCCTGAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162199416 Original CRISPR AATGAGCAAGTCGCCGCCGC AGG (reversed) Intergenic
No off target data available for this crispr