ID: 1162199421

View in Genome Browser
Species Human (GRCh38)
Location 19:9009919-9009941
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162199416_1162199421 8 Left 1162199416 19:9009888-9009910 CCTGCGGCGGCGACTTGCTCATT No data
Right 1162199421 19:9009919-9009941 TGAGAGCTGGGCACAGATACTGG No data
1162199415_1162199421 9 Left 1162199415 19:9009887-9009909 CCCTGCGGCGGCGACTTGCTCAT No data
Right 1162199421 19:9009919-9009941 TGAGAGCTGGGCACAGATACTGG No data
1162199411_1162199421 29 Left 1162199411 19:9009867-9009889 CCAGATCGGAGCTCCTGGAACCC No data
Right 1162199421 19:9009919-9009941 TGAGAGCTGGGCACAGATACTGG No data
1162199414_1162199421 16 Left 1162199414 19:9009880-9009902 CCTGGAACCCTGCGGCGGCGACT No data
Right 1162199421 19:9009919-9009941 TGAGAGCTGGGCACAGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162199421 Original CRISPR TGAGAGCTGGGCACAGATAC TGG Intergenic
No off target data available for this crispr