ID: 1162199477

View in Genome Browser
Species Human (GRCh38)
Location 19:9010266-9010288
Sequence TACCTGGCCAGCAGGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162199466_1162199477 5 Left 1162199466 19:9010238-9010260 CCTCAGTGAGCCCCAGCCCAGTC No data
Right 1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG No data
1162199468_1162199477 -6 Left 1162199468 19:9010249-9010271 CCCAGCCCAGTCCCACTTACCTG No data
Right 1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG No data
1162199464_1162199477 15 Left 1162199464 19:9010228-9010250 CCGTCCAGCTCCTCAGTGAGCCC No data
Right 1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG No data
1162199463_1162199477 26 Left 1162199463 19:9010217-9010239 CCTATATGAATCCGTCCAGCTCC No data
Right 1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG No data
1162199467_1162199477 -5 Left 1162199467 19:9010248-9010270 CCCCAGCCCAGTCCCACTTACCT No data
Right 1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG No data
1162199465_1162199477 11 Left 1162199465 19:9010232-9010254 CCAGCTCCTCAGTGAGCCCCAGC No data
Right 1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG No data
1162199469_1162199477 -7 Left 1162199469 19:9010250-9010272 CCAGCCCAGTCCCACTTACCTGG No data
Right 1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162199477 Original CRISPR TACCTGGCCAGCAGGTGAGG AGG Intergenic
No off target data available for this crispr