ID: 1162206354

View in Genome Browser
Species Human (GRCh38)
Location 19:9059054-9059076
Sequence CCATTTTACAAGCACTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162206344_1162206354 19 Left 1162206344 19:9059012-9059034 CCAGTAGGACAGGATTCTAGGAG No data
Right 1162206354 19:9059054-9059076 CCATTTTACAAGCACTCCAGGGG No data
1162206341_1162206354 21 Left 1162206341 19:9059010-9059032 CCCCAGTAGGACAGGATTCTAGG No data
Right 1162206354 19:9059054-9059076 CCATTTTACAAGCACTCCAGGGG No data
1162206343_1162206354 20 Left 1162206343 19:9059011-9059033 CCCAGTAGGACAGGATTCTAGGA No data
Right 1162206354 19:9059054-9059076 CCATTTTACAAGCACTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162206354 Original CRISPR CCATTTTACAAGCACTCCAG GGG Intergenic
No off target data available for this crispr