ID: 1162207371

View in Genome Browser
Species Human (GRCh38)
Location 19:9065827-9065849
Sequence CAGGCCCTGATTGGCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162207363_1162207371 -8 Left 1162207363 19:9065812-9065834 CCCCTCGCCTATTCCCAGGCCCT No data
Right 1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG No data
1162207353_1162207371 29 Left 1162207353 19:9065775-9065797 CCTAATCCCTGCGAGGCTGGGCG No data
Right 1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG No data
1162207357_1162207371 23 Left 1162207357 19:9065781-9065803 CCCTGCGAGGCTGGGCGGGGCTG No data
Right 1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG No data
1162207364_1162207371 -9 Left 1162207364 19:9065813-9065835 CCCTCGCCTATTCCCAGGCCCTG No data
Right 1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG No data
1162207365_1162207371 -10 Left 1162207365 19:9065814-9065836 CCTCGCCTATTCCCAGGCCCTGA No data
Right 1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG No data
1162207358_1162207371 22 Left 1162207358 19:9065782-9065804 CCTGCGAGGCTGGGCGGGGCTGG No data
Right 1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162207371 Original CRISPR CAGGCCCTGATTGGCTCCCT GGG Intergenic
No off target data available for this crispr