ID: 1162209032

View in Genome Browser
Species Human (GRCh38)
Location 19:9077214-9077236
Sequence GGCCTCAGCCGTCTGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162209032_1162209035 3 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209035 19:9077240-9077262 AATGGCGTCAGCCCCAAGTGAGG No data
1162209032_1162209036 7 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209036 19:9077244-9077266 GCGTCAGCCCCAAGTGAGGACGG No data
1162209032_1162209038 9 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209038 19:9077246-9077268 GTCAGCCCCAAGTGAGGACGGGG No data
1162209032_1162209037 8 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209037 19:9077245-9077267 CGTCAGCCCCAAGTGAGGACGGG No data
1162209032_1162209043 15 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209043 19:9077252-9077274 CCCAAGTGAGGACGGGGCAGGGG No data
1162209032_1162209039 13 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG No data
1162209032_1162209041 14 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209041 19:9077251-9077273 CCCCAAGTGAGGACGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162209032 Original CRISPR GGCCTCAGCCGTCTGCACCC AGG (reversed) Intergenic