ID: 1162209034

View in Genome Browser
Species Human (GRCh38)
Location 19:9077235-9077257
Sequence CTTGGGGCTGACGCCATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162209034_1162209043 -6 Left 1162209034 19:9077235-9077257 CCTAAAATGGCGTCAGCCCCAAG No data
Right 1162209043 19:9077252-9077274 CCCAAGTGAGGACGGGGCAGGGG No data
1162209034_1162209041 -7 Left 1162209034 19:9077235-9077257 CCTAAAATGGCGTCAGCCCCAAG No data
Right 1162209041 19:9077251-9077273 CCCCAAGTGAGGACGGGGCAGGG No data
1162209034_1162209039 -8 Left 1162209034 19:9077235-9077257 CCTAAAATGGCGTCAGCCCCAAG No data
Right 1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162209034 Original CRISPR CTTGGGGCTGACGCCATTTT AGG (reversed) Intergenic