ID: 1162209039

View in Genome Browser
Species Human (GRCh38)
Location 19:9077250-9077272
Sequence GCCCCAAGTGAGGACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162209032_1162209039 13 Left 1162209032 19:9077214-9077236 CCTGGGTGCAGACGGCTGAGGCC No data
Right 1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG No data
1162209034_1162209039 -8 Left 1162209034 19:9077235-9077257 CCTAAAATGGCGTCAGCCCCAAG 0: 11
1: 47
2: 46
3: 38
4: 93
Right 1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162209039 Original CRISPR GCCCCAAGTGAGGACGGGGC AGG Intergenic
No off target data available for this crispr