ID: 1162215694

View in Genome Browser
Species Human (GRCh38)
Location 19:9131965-9131987
Sequence AAAAGGAATCTGGCCAAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162215694_1162215701 6 Left 1162215694 19:9131965-9131987 CCGCACTTGGCCAGATTCCTTTT No data
Right 1162215701 19:9131994-9132016 GACTAATTCATACTTAGGTAGGG No data
1162215694_1162215699 1 Left 1162215694 19:9131965-9131987 CCGCACTTGGCCAGATTCCTTTT No data
Right 1162215699 19:9131989-9132011 GAAGGGACTAATTCATACTTAGG No data
1162215694_1162215702 10 Left 1162215694 19:9131965-9131987 CCGCACTTGGCCAGATTCCTTTT No data
Right 1162215702 19:9131998-9132020 AATTCATACTTAGGTAGGGAAGG No data
1162215694_1162215703 20 Left 1162215694 19:9131965-9131987 CCGCACTTGGCCAGATTCCTTTT No data
Right 1162215703 19:9132008-9132030 TAGGTAGGGAAGGAGTCCCTAGG No data
1162215694_1162215700 5 Left 1162215694 19:9131965-9131987 CCGCACTTGGCCAGATTCCTTTT No data
Right 1162215700 19:9131993-9132015 GGACTAATTCATACTTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162215694 Original CRISPR AAAAGGAATCTGGCCAAGTG CGG (reversed) Intergenic
No off target data available for this crispr