ID: 1162219120

View in Genome Browser
Species Human (GRCh38)
Location 19:9161108-9161130
Sequence AACGCTCATGTGCCTCCGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162219120_1162219125 20 Left 1162219120 19:9161108-9161130 CCCGGCGGAGGCACATGAGCGTT 0: 1
1: 0
2: 1
3: 4
4: 34
Right 1162219125 19:9161151-9161173 TGAGTGTAGGCAGTGTGGCAAGG 0: 1
1: 0
2: 2
3: 27
4: 325
1162219120_1162219123 7 Left 1162219120 19:9161108-9161130 CCCGGCGGAGGCACATGAGCGTT 0: 1
1: 0
2: 1
3: 4
4: 34
Right 1162219123 19:9161138-9161160 TAAAGAAACGAGTTGAGTGTAGG 0: 1
1: 0
2: 1
3: 8
4: 135
1162219120_1162219126 28 Left 1162219120 19:9161108-9161130 CCCGGCGGAGGCACATGAGCGTT 0: 1
1: 0
2: 1
3: 4
4: 34
Right 1162219126 19:9161159-9161181 GGCAGTGTGGCAAGGCCTTCAGG 0: 1
1: 0
2: 6
3: 31
4: 434
1162219120_1162219124 15 Left 1162219120 19:9161108-9161130 CCCGGCGGAGGCACATGAGCGTT 0: 1
1: 0
2: 1
3: 4
4: 34
Right 1162219124 19:9161146-9161168 CGAGTTGAGTGTAGGCAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162219120 Original CRISPR AACGCTCATGTGCCTCCGCC GGG (reversed) Exonic
920516990 1:206592491-206592513 CACCCACATGTGCTTCCGCCTGG - Intronic
1063232038 10:4074892-4074914 AACACTGGTGTGCCTCTGCCGGG - Intergenic
1067171341 10:43909277-43909299 AACGCACATGTGCCCCTGCAGGG + Intergenic
1067234946 10:44439493-44439515 AGCACTCATGTGCCTTGGCCAGG - Intergenic
1067435526 10:46273739-46273761 AAAGGTCCTGTGCCTCCCCCTGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1081556333 11:44165438-44165460 ATAGCTCAAGTGCCTCAGCCTGG - Intronic
1083700888 11:64477053-64477075 AGCCCTCATCTGCCTCCGCCTGG + Intergenic
1090381971 11:126333714-126333736 AAAGTCCACGTGCCTCCGCCTGG - Intronic
1106247940 13:27964811-27964833 AACTCTCATGGTCCTCTGCCAGG + Intronic
1122909558 14:104820741-104820763 AACCTTCATGTGCCTCTGCCTGG + Intergenic
1127689778 15:61384176-61384198 AAGGCCCATGTGGCTCCACCTGG - Intergenic
1135848096 16:25937492-25937514 TACGCTCCTGTTCCTCTGCCTGG - Intronic
1137867867 16:51919565-51919587 TATGCTCATGTGCCACCCCCTGG - Intergenic
1142214659 16:88824672-88824694 CACCCTCCTGTGCCTCCCCCAGG + Intronic
1145289360 17:21530989-21531011 CACCCTCATGTGCCTCAGGCGGG + Exonic
1158221427 18:55154784-55154806 AACCCTCATGTGAATCCGTCTGG + Intergenic
1161217745 19:3102934-3102956 AACGGTCATGTGTATCCCCCAGG + Intronic
1162219120 19:9161108-9161130 AACGCTCATGTGCCTCCGCCGGG - Exonic
1165955356 19:39499022-39499044 AGCGCTCATTTTCCTCCCCCAGG + Exonic
926112737 2:10193288-10193310 AATGTTCCTGTGCCTCCTCCCGG + Intronic
931606260 2:64055740-64055762 AACCCTCATGTGCTGCTGCCGGG - Intergenic
934017662 2:87906438-87906460 AACGCTCATTTGCCTCCAACAGG - Intergenic
937155320 2:119714824-119714846 AAGTCCCATGTGCCTCAGCCAGG - Intergenic
1169939326 20:10919847-10919869 GACCCTCATGGACCTCCGCCAGG - Intergenic
1172342828 20:34172192-34172214 AACGTTCTTGTGCCTCCTACAGG + Intergenic
1179106230 21:38403251-38403273 AACACTCAGCTGCCTCCTCCAGG - Intronic
1179265568 21:39799400-39799422 CACACTCTTGGGCCTCCGCCAGG + Intronic
955583703 3:60453432-60453454 AATGCTCCAATGCCTCCGCCAGG + Intronic
965112507 3:164446011-164446033 AACGTTGCTGTGCCTCTGCCAGG + Intergenic
979920476 4:126490217-126490239 AACGCTCAGCCGCCTCCCCCTGG + Intergenic
989111035 5:37906862-37906884 AAGCCTCATGTGCTTCCCCCAGG - Intergenic
1010130470 6:72486728-72486750 AACGTTCATTTGCCTCTTCCTGG + Intergenic
1018378910 6:163240168-163240190 GCCGCACCTGTGCCTCCGCCGGG + Intronic
1044564294 8:93646772-93646794 AATGCTCGTGTGCCTCCGCCGGG - Intergenic
1053168647 9:35862502-35862524 AGCCCTCAAATGCCTCCGCCAGG - Intergenic
1057131982 9:92660572-92660594 AAAGCTCATGTGTCTTGGCCTGG - Intronic
1057727712 9:97579938-97579960 AAAGCTCATGTGCCTCCATGTGG - Intronic
1062278508 9:135741700-135741722 CACGCTCATCGGCCTACGCCAGG - Intronic
1199126819 X:144132107-144132129 AACGCTCATTTGCCTCCAACAGG + Intergenic