ID: 1162222064

View in Genome Browser
Species Human (GRCh38)
Location 19:9186144-9186166
Sequence GGTGGCAGACAGCCACAAAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162222064_1162222070 25 Left 1162222064 19:9186144-9186166 CCGGTTTGTGGCTGTCTGCCACC 0: 1
1: 0
2: 3
3: 25
4: 227
Right 1162222070 19:9186192-9186214 CCCCCACCTCTGTGGCCTCCTGG 0: 1
1: 4
2: 10
3: 61
4: 564
1162222064_1162222068 17 Left 1162222064 19:9186144-9186166 CCGGTTTGTGGCTGTCTGCCACC 0: 1
1: 0
2: 3
3: 25
4: 227
Right 1162222068 19:9186184-9186206 ATCATGAACCCCCACCTCTGTGG 0: 1
1: 2
2: 10
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162222064 Original CRISPR GGTGGCAGACAGCCACAAAC CGG (reversed) Exonic
900551292 1:3257256-3257278 GAAGGCAGAGAGCCAGAAACTGG - Intronic
900813901 1:4828612-4828634 AGTGACAGTCAGCCACAAGCTGG + Intergenic
903644587 1:24886911-24886933 TGTGACACAGAGCCACAAACTGG + Intergenic
904006229 1:27364690-27364712 GGAGGCAGACAGTCAGATACTGG + Intronic
905648414 1:39640207-39640229 GGTGGCAGTCACCCCCAAAAGGG + Intergenic
907560502 1:55383104-55383126 GGTGGCCCACAGCCACTGACCGG - Intergenic
910127838 1:83863341-83863363 GAAGGAAGCCAGCCACAAACAGG + Intergenic
911803306 1:102173448-102173470 GGAGGCAGAGAGGCAGAAACAGG - Intergenic
912377511 1:109223149-109223171 GGGGGAAGACAGGCACTAACTGG - Intronic
913546296 1:119872075-119872097 TGTGCCTAACAGCCACAAACTGG + Intergenic
914410119 1:147419394-147419416 GGTGGCAAATAGCCACACAGTGG - Intergenic
916499460 1:165374525-165374547 GGTGACTGACAGCCAGAAAGGGG - Intergenic
919514162 1:198500962-198500984 GGTGGCAGACAAGAACAAATGGG - Intergenic
922962260 1:229658334-229658356 GGTGGCAGCCAGCTCCAACCTGG - Intronic
923011318 1:230090155-230090177 GGTGACAGACACCCACATATGGG - Intronic
924038388 1:239958366-239958388 TGTGGGAGACAGACACAAAAGGG + Intergenic
924437359 1:244054170-244054192 GGAGGCAGACAGCACCAAAAAGG + Exonic
924830459 1:247588731-247588753 GACGGCAGACAGCCACATAGCGG - Exonic
924858225 1:247895949-247895971 GCTTGCAGATAGCCACACACCGG - Exonic
924860920 1:247921374-247921396 GGTGGCAGACAGCCGCATAGCGG - Exonic
924874278 1:248084217-248084239 GGTGGCAGACAGCCGCATAGCGG + Intronic
924890507 1:248273436-248273458 GGTGGCAGACAGCCGCATAGCGG + Exonic
924892159 1:248295200-248295222 GGTGGCAGACAGCCGCATAGCGG + Exonic
924896927 1:248349131-248349153 GCTGGCAGACAGCCACATAGCGG - Exonic
924905998 1:248453163-248453185 GGTTGCACACAGCCACATAGCGG - Exonic
924917962 1:248593384-248593406 GATGGCAGATAGCCACATAGCGG + Exonic
924921892 1:248638874-248638896 GGTTGCACACAGCCACATAGCGG + Exonic
1062796581 10:349164-349186 GGTCGTAGCCAGACACAAACGGG + Intronic
1062834763 10:628494-628516 GGTGGGACAGAGACACAAACAGG + Intronic
1064562496 10:16606876-16606898 GATGGCCAACAGCCACAAATAGG - Intronic
1064899284 10:20276083-20276105 GGAGGAAGACAGCCCCAAAATGG + Intronic
1068587540 10:58816233-58816255 GGTGACACAAAGCCACAAAGTGG - Intronic
1068937328 10:62648675-62648697 GGTGGCAGACAGACAGGCACTGG - Intronic
1071015219 10:80988944-80988966 CGTGGAAGACAGCCATAGACAGG + Intergenic
1071907411 10:90188787-90188809 GGTGACAGAATGCCACAGACTGG - Intergenic
1072690687 10:97570699-97570721 GGGAGCAGGCAGCCACACACGGG + Exonic
1072861813 10:99014018-99014040 GGTGGCAGAGAGAGACACACTGG + Intronic
1074100608 10:110351988-110352010 TGTGACAGATAACCACAAACTGG - Intergenic
1074883095 10:117673451-117673473 GTGAGCAGACAGCCACAGACAGG - Intergenic
1077576971 11:3391355-3391377 GGTGACAGATGGCTACAAACCGG + Intergenic
1077722204 11:4640192-4640214 GGTGGCAAATGGCCACAAAGCGG - Exonic
1077726710 11:4682330-4682352 GGTGGCAGATGGCCACATAACGG + Exonic
1077746741 11:4915264-4915286 GGTGGCAGATAGCCACAAAGCGG + Exonic
1077753383 11:4999351-4999373 GATGGCAGATAGCAACAAAACGG - Exonic
1077760667 11:5093044-5093066 GGTTGCAGATGGCCACAAAGTGG - Intergenic
1077786469 11:5389797-5389819 GGTGGCAGATGGCCACAAGGCGG - Exonic
1077846186 11:6027299-6027321 GGTGGCAGATGGCCACATAACGG + Exonic
1077947803 11:6921412-6921434 GCTTGCAGACAGCCACATACCGG - Exonic
1079008346 11:16808638-16808660 GGTTGCAGTCAGCCCCAAAAAGG - Intronic
1079040185 11:17052420-17052442 GGTGACAGATGGCTACAAACCGG - Intergenic
1079986000 11:27201527-27201549 GGTGGCAGCCAGCCAGACAATGG + Intergenic
1082897108 11:58203758-58203780 GGTGGCAGATCGCCACAAAGTGG + Exonic
1082898176 11:58215146-58215168 GGTGGCAGATCGCCACAAAGTGG - Exonic
1082899332 11:58228479-58228501 GGTGGCAGATAGCCACATAGCGG + Exonic
1082904607 11:58292379-58292401 GGTGGCAGATGGCCACATAGCGG + Intergenic
1083263216 11:61534193-61534215 GAGAGCACACAGCCACAAACTGG + Intronic
1084228914 11:67736153-67736175 GGTGACAGATGGCTACAAACCGG + Intergenic
1084707066 11:70821743-70821765 CGTGGCAGAGCGCCACAGACAGG - Intronic
1084846361 11:71903555-71903577 GGTGACAGATGGCTACAAACTGG - Intronic
1085242686 11:75071692-75071714 GGCGGCAGATAGCCACATAGCGG + Intergenic
1085244538 11:75089314-75089336 GGTGGCAGATAGCCACATAGCGG + Exonic
1085249288 11:75131580-75131602 GGTGGCAGATAGCTACATAGCGG + Intronic
1086441409 11:86833071-86833093 GGTGACAGATGGCTACAAACCGG + Intronic
1088779843 11:113123622-113123644 GGTGGGAGACATCCAAATACTGG + Intronic
1088792889 11:113241784-113241806 AGTGGCAGACAGCAGCAAATGGG + Intronic
1089526028 11:119097276-119097298 GGTGGCAGAGAGCCTCCAGCTGG - Exonic
1091346347 11:134856841-134856863 GGTGGCAGCCAGGCACACTCAGG - Intergenic
1091604063 12:1935510-1935532 GGTGGCGGCCATCCACACACAGG + Intergenic
1091628753 12:2142070-2142092 GGTGGGGGACAGCCACCACCTGG + Intronic
1092201861 12:6589702-6589724 GGTTGCAGTCAGCCAAAATCAGG + Intronic
1092433577 12:8428220-8428242 GGTGGCAGATGGCTACAAACTGG + Intergenic
1096507898 12:52107697-52107719 GGTGACAGATGGCTACAAACCGG - Intergenic
1096706301 12:53424505-53424527 GGTGGGAGACAGACACATCCTGG + Intronic
1097717701 12:62983851-62983873 GGTGGCAGACTGCCACCTTCTGG + Intergenic
1100438017 12:94589629-94589651 GGGGGCACACAGCCAGTAACCGG + Intronic
1101210841 12:102534007-102534029 GCTGGCAGACAGCCACACTAGGG - Intergenic
1104035957 12:125097184-125097206 GGTTGCAGAAAGCCCCAAAATGG - Intronic
1106877591 13:34090618-34090640 GTTGGCAGACAGCAAGAAATTGG - Intergenic
1107545717 13:41431817-41431839 GGTGACAGATGGCTACAAACCGG + Intergenic
1107547032 13:41443089-41443111 GGTGACAGATGGCTACAAACCGG - Intergenic
1108430974 13:50353322-50353344 GGAGGAATACAGCCAGAAACAGG + Intronic
1109840389 13:67911378-67911400 GGTGACAGATGGCTACAAACCGG - Intergenic
1111311179 13:86488387-86488409 GCTGGCAAACATCCATAAACAGG + Intergenic
1111537619 13:89624637-89624659 TCTGGCAGACAAGCACAAACTGG + Intergenic
1113876498 13:113597919-113597941 GGTGGCAGGTGGCCAGAAACGGG + Intronic
1120279424 14:82420266-82420288 GGTAGCATACAACTACAAACTGG - Intergenic
1124189091 15:27556166-27556188 GATGAGAGAGAGCCACAAACTGG + Intergenic
1125761598 15:42100004-42100026 GTCGGCAGACAGGCAGAAACAGG - Intergenic
1129415489 15:75375278-75375300 GGAGGCAGACACACACACACAGG + Intronic
1130547014 15:84864091-84864113 ACTGGCAGAGAGCCACAATCTGG + Intronic
1131114788 15:89788354-89788376 GAAGGCAGACAGACACAAAAAGG + Intronic
1131136611 15:89941541-89941563 TGTGGCAGACAGACACTAAGAGG + Intergenic
1131176601 15:90213240-90213262 GGTGGCACACAGCCAGTAAGTGG + Intronic
1132198866 15:99933856-99933878 GATGACCCACAGCCACAAACAGG + Intergenic
1133065609 16:3204609-3204631 GGTGGCACACGGCGACAAAGTGG - Exonic
1133330017 16:4967087-4967109 GGTCCCACAGAGCCACAAACCGG + Intronic
1133807396 16:9135988-9136010 GATGGCAGACAGCTAAATACAGG + Intergenic
1136074493 16:27807456-27807478 CGTAGCAGATACCCACAAACAGG + Intronic
1139023872 16:62788660-62788682 AAAGGCAGAGAGCCACAAACTGG - Intergenic
1139923705 16:70474482-70474504 GGTGGCATGCAGCCCCAAGCTGG - Intronic
1139965789 16:70744653-70744675 GGTGGCACACAGCCACCTGCAGG + Intronic
1141962283 16:87417273-87417295 AGCTGCAGCCAGCCACAAACAGG - Intronic
1144857533 17:18277939-18277961 GTGGGCAGACAGCCCCAATCCGG - Exonic
1144922420 17:18775503-18775525 GCAGGCAGTCAGCCAAAAACTGG - Intronic
1148186259 17:45646462-45646484 GGTAACAGACAGCCACAGATGGG + Intergenic
1148218412 17:45846442-45846464 GGCGGCAGGCAGCCACAGCCAGG - Exonic
1148337125 17:46849464-46849486 GGTGGCAGACAGACCCCACCAGG - Intronic
1148777104 17:50101987-50102009 AGTGACAGACAGGCACCAACAGG - Intronic
1149537893 17:57446481-57446503 AGTGGCAGAGAGCCCCAAAGGGG - Intronic
1151941718 17:77296453-77296475 AGAGACAGACAGACACAAACAGG + Intronic
1152517076 17:80831846-80831868 GGTGACATACAGGCACACACAGG - Intronic
1153166058 18:2263265-2263287 GATGACAGACAGCCCCTAACTGG - Intergenic
1153890413 18:9509178-9509200 GGTTGCAGAAACCCATAAACTGG - Intronic
1154384752 18:13883096-13883118 GGGAGAAGACAGCCACACACAGG - Exonic
1155659651 18:28232689-28232711 GGTGGCAGACAAACACATAAAGG + Intergenic
1156378905 18:36539677-36539699 GGTGATAAACAGCCCCAAACAGG - Intronic
1157122423 18:44924078-44924100 GGCTGTAGACAGACACAAACAGG + Intronic
1157306293 18:46520015-46520037 GGTGGCACAGAGGCACACACAGG + Intronic
1157306592 18:46521903-46521925 GGTGGAAGACAGACACACAGAGG + Intronic
1157353599 18:46913660-46913682 GGTGGCAGTCATTCACAAAAAGG - Intronic
1158550301 18:58430330-58430352 GGTGGGAGACAGCCTTAAAAGGG + Intergenic
1158619657 18:59021646-59021668 GGTGGCAGATTGCCACACATGGG - Intergenic
1160809972 19:1009066-1009088 GATGGCCGACAGGCACAACCAGG - Intronic
1161088676 19:2346803-2346825 AGACGCAGACAGACACAAACAGG - Intronic
1162211200 19:9093607-9093629 GGTGGCAGATGGCCACGAACCGG - Exonic
1162222064 19:9186144-9186166 GGTGGCAGACAGCCACAAACCGG - Exonic
1162222681 19:9191591-9191613 GGTGACAGATGGCCACAAACCGG - Intergenic
1162224017 19:9204667-9204689 GGTGACAGATGGCCACGAACCGG - Intergenic
1162225092 19:9214453-9214475 GGTGGCAGATGGCCACAAACCGG + Exonic
1162227445 19:9235506-9235528 GGTGGCAGATGGCCACAAACCGG - Intergenic
1162229189 19:9251460-9251482 GGTGACAGATGGCCACAAACCGG - Exonic
1162230444 19:9261515-9261537 GGTGACAGATGTCCACAAACCGG + Intergenic
1162230962 19:9265935-9265957 GGTGACAAATGGCCACAAACTGG + Intergenic
1162232460 19:9278984-9279006 GGTGACAGATGGCCACATACCGG + Intergenic
1162363317 19:10232229-10232251 GCTGGAAGGCAGGCACAAACTGG - Intergenic
1163066439 19:14799752-14799774 GGTGACAGACGGCCACGAAGCGG + Exonic
1163069573 19:14827857-14827879 GGTGACAGATGGCCACAAACCGG + Exonic
1163071017 19:14841493-14841515 GGTGACAGATGGCCACAAACCGG + Exonic
1163073293 19:14864331-14864353 GGTGACAGATGGCCACAAACTGG + Intergenic
1163075462 19:14887037-14887059 GGTGACAGATGGCCACAAAGTGG + Intergenic
1163076016 19:14892420-14892442 GGTGACAGATGGCCACAAACCGG + Intergenic
1163077123 19:14903789-14903811 GGTGACAGATGGCCACAAACTGG + Intergenic
1163078329 19:14916777-14916799 GGTGACAGATGGCCACAAACTGG - Intergenic
1163079533 19:14927474-14927496 GGTGACAGATGGCCACAAACCGG - Intergenic
1163108432 19:15141662-15141684 GGTGGCAGATGGCCACATAGCGG + Intergenic
1163697931 19:18773364-18773386 GTTGGGAGAGAGCCACAAACTGG - Intronic
1164507573 19:28872204-28872226 GGTGGCAGAAAGGCACATTCAGG - Intergenic
1166731062 19:45059305-45059327 GGTGGCAGATCTCAACAAACAGG + Exonic
926311233 2:11677618-11677640 GGAGGCAGACAGCACCATACAGG + Exonic
927881162 2:26691284-26691306 GGAGGCAGTCAGCCAGAAGCTGG - Intergenic
933783868 2:85822605-85822627 GGTTGCAGACAGCCACTTTCTGG - Intergenic
934590628 2:95546949-95546971 GGTGACAGATGGCCACAAATCGG - Intergenic
937240765 2:120460968-120460990 GGTGGTAGACAGGCACCAAAAGG - Intergenic
938450364 2:131413528-131413550 GGTGGAACACAGCAACAAAGAGG + Intergenic
940871299 2:158862707-158862729 GGTGACAGATGGCTACAAACCGG - Intronic
941992782 2:171573223-171573245 CGTAGCAAACAACCACAAACTGG - Intergenic
943676127 2:190717932-190717954 GGTGGCAGACATCCAAATACTGG - Intergenic
946935510 2:224716302-224716324 GCGGGCAGAGATCCACAAACTGG - Intergenic
947555883 2:231092830-231092852 GGTTGCAGATAGCCTCAAACCGG - Intronic
948141690 2:235677870-235677892 GGGGGCAGAAAGGCAGAAACTGG - Intronic
948312431 2:236998778-236998800 GGAGGAAGACAGCAAAAAACAGG + Intergenic
1170574211 20:17650311-17650333 GGTGGCAAACACTCAGAAACAGG - Intronic
1171405428 20:24909526-24909548 GGAGGCAGCCAGCCCCAACCAGG - Intergenic
1171900468 20:30851666-30851688 GGTGGCCGAGAGGCACAGACTGG - Intergenic
1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG + Exonic
1173286058 20:41672335-41672357 TGGGGCAGAGAGCCCCAAACAGG - Intergenic
1175208469 20:57329955-57329977 GGTGGCAGGGAGCCCCCAACTGG + Exonic
1175416511 20:58804796-58804818 GGTCAAAGACAGCCACATACTGG - Intergenic
1175539943 20:59742112-59742134 GGTGGTATACAGGCACACACTGG - Intronic
1175952759 20:62592206-62592228 GGTGGCAGAGAGGCACATTCTGG + Intergenic
1178443919 21:32621462-32621484 GGTGACAGATGGCTACAAACTGG - Intergenic
1179547388 21:42121984-42122006 GGTGGCAGAGAGCGAGAAGCAGG + Intronic
1179610498 21:42547219-42547241 GGTGTCAGACAGAAACACACAGG + Intronic
1181494259 22:23279170-23279192 GCTGGCTGACAGCCACAGTCAGG - Intronic
1181534783 22:23535743-23535765 GGTGGCACACAGCGTCACACAGG - Intergenic
1181728331 22:24827027-24827049 AGAGGCAGAGAGCCTCAAACAGG - Intronic
1184184839 22:42857490-42857512 CGTGGCAGGCAGCCACACCCGGG - Intronic
949437145 3:4041747-4041769 GGTAGCACACAGCAACAAATTGG - Intronic
951467254 3:23014599-23014621 GGTGGCAGATAGACACTAAGAGG + Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
955521541 3:59780082-59780104 GGCAGGAGACAGCCACACACAGG - Intronic
956179226 3:66501463-66501485 GGGGCCAGACAGCCCCAAAACGG - Intergenic
957045501 3:75370969-75370991 GGTGACAGATGGCTACAAACCGG + Intergenic
959981694 3:112524768-112524790 GGTGACAGATGGCCACAAATTGG + Intergenic
961274005 3:125712502-125712524 GGTGACAGATGGCTACAAACCGG - Intergenic
961276883 3:125734656-125734678 GGTGACAGATGGCTACAAACCGG - Intergenic
961877539 3:130035098-130035120 GGTGACAGATGGCTACAAACAGG + Intergenic
962456429 3:135569345-135569367 GAGGCCAGACAGCCACTAACGGG + Intergenic
966887476 3:184384749-184384771 GGTGGCAGACAGCCGGAGCCTGG + Intronic
967112176 3:186303708-186303730 GGTGGCAGACAGCTAGAGAGTGG - Intronic
968989779 4:3902146-3902168 GGTGACAGATGGCTACAAACCGG + Intergenic
969026224 4:4174865-4174887 GGTGACAGATGGCTACAAACCGG + Intergenic
969311449 4:6355097-6355119 GGGGACAGATAGCAACAAACAGG - Intronic
969716008 4:8868430-8868452 GGTCGCTCACAGCCACAAGCAGG + Intronic
969787353 4:9469394-9469416 GGTGACAGATGGCTACAAACTGG - Intergenic
969825536 4:9755239-9755261 GGTGACAGATGGCTACAAACCGG - Intergenic
973767988 4:54181106-54181128 GTTGCCAGAGAGCCACAAAGTGG + Intronic
974951897 4:68592965-68592987 GAAGGCAGAAAGCCACAAGCTGG + Intronic
975423480 4:74197314-74197336 AGTAGCAGTCAGTCACAAACAGG + Intronic
982702309 4:158671266-158671288 GGAGGCAGAGAGCCAGCAACAGG + Intronic
985199069 4:187465536-187465558 GCTGGAAGTCAGCCACAAAGAGG - Intergenic
985935024 5:3090877-3090899 ACTGCCAGATAGCCACAAACTGG + Intergenic
986278856 5:6306260-6306282 AGTAGCAGCCAGCCACAAACTGG + Intergenic
990757299 5:59087750-59087772 GGTGTGAGAGAGCCTCAAACAGG - Intronic
995957590 5:117796737-117796759 GGAGGCAGAGAGACAGAAACAGG - Intergenic
997384612 5:133462854-133462876 GGTTACAGAAAGCCCCAAACTGG - Intronic
998131852 5:139655413-139655435 GGTGGCAGGCAGAGACAAAGGGG - Intronic
1000336203 5:160243395-160243417 GGTGACACACAGCCACACAAAGG - Intergenic
1002267391 5:178045003-178045025 GGTGGGACACAGCCCCACACAGG + Intronic
1004429410 6:15530296-15530318 GCTGAGAGACAGCCACACACGGG - Intronic
1004513974 6:16306430-16306452 GGCGCCAGAGAGCCGCAAACTGG - Exonic
1004957098 6:20739878-20739900 GGTAACAGACAGCCAAAGACCGG - Intronic
1005804544 6:29462126-29462148 GCTGGCAGACAGCCACGTATCGG - Exonic
1007841574 6:44720433-44720455 GGTGGTGGGCAGCCAGAAACAGG + Intergenic
1011688779 6:89846206-89846228 CGTGGCAGACAGGCAAAACCCGG + Intronic
1014295693 6:119614366-119614388 GGTGTCAGATAACAACAAACAGG - Intergenic
1015676593 6:135756791-135756813 GTTCACAGACAGCAACAAACAGG + Intergenic
1018328778 6:162705168-162705190 TGTGTCAGACAGACACAAATTGG + Intronic
1019338738 7:497586-497608 GTTGTCACTCAGCCACAAACGGG + Intronic
1019595698 7:1857386-1857408 GGAGGCAGCCAGCCACAGCCTGG + Intronic
1019884129 7:3889385-3889407 GGTGGCAGAAAGACAAAAAGAGG + Intronic
1020312594 7:6880186-6880208 GGTGACAGATGGCTACAAACCGG + Intergenic
1023015183 7:35961556-35961578 GGTGGCTGAAAGCCACAGAAAGG + Intergenic
1023674337 7:42614734-42614756 GGCGGCAGACAGGCAGAGACAGG - Intergenic
1024065764 7:45733136-45733158 GGTGGCTGAAAGCCACAGAAAGG - Intergenic
1025143744 7:56486650-56486672 GCTGGCAGAGAAACACAAACTGG - Intergenic
1026452195 7:70539280-70539302 GTTGACAGAAAGCCCCAAACTGG - Intronic
1027358115 7:77379558-77379580 AGAGGCAGACAGACACACACTGG - Intronic
1033498036 7:141919238-141919260 GGTTACAGACAGCCACATAACGG - Exonic
1034820335 7:154211254-154211276 GCTGGCAGACAGCCCCCACCTGG + Intronic
1036818535 8:11920369-11920391 GGTGACAGATGGCTACAAACCGG + Intergenic
1036904528 8:12696839-12696861 GGTGACAGATGGCTACAAACGGG + Intergenic
1046704349 8:117434096-117434118 GGGGGCACAGAGGCACAAACTGG + Intergenic
1047443502 8:124899803-124899825 GGTGGCAGGCTGCCCCAAAATGG + Intergenic
1051725374 9:20083434-20083456 TGAGGCAGAATGCCACAAACTGG + Intergenic
1053168216 9:35859600-35859622 GCTGGCAGATAGCCACATAACGG + Intergenic
1056688325 9:88784767-88784789 GTTGGCAGAGAGCCACAAGATGG + Intergenic
1056864353 9:90216391-90216413 GGTGACAGATGGCTACAAACCGG - Intergenic
1056915548 9:90743049-90743071 GGTGACAGATGGCTACAAACTGG + Intergenic
1057963397 9:99478800-99478822 GGGGCCAGCCAGCCACTAACAGG + Intergenic
1058032472 9:100215232-100215254 GGTGGCAGCCAGCCAAAAGGGGG - Intronic
1058391874 9:104504625-104504647 GGTTGCAGATGGCCACATACCGG - Exonic
1058399574 9:104599029-104599051 GGTTGCAGATAGCCACATAGCGG + Exonic
1058400037 9:104605243-104605265 GGTTGCAGATAGCCACATAGCGG + Exonic
1058400869 9:104617820-104617842 GGTTGCAGATAGCCACATAGCGG + Exonic
1058422255 9:104843185-104843207 GGTGAGAGACAGAAACAAACAGG - Intronic
1059335080 9:113564012-113564034 GGTGGGAGCCAGCCACAAGTTGG + Intronic
1061012059 9:127961594-127961616 GGTGGAAGACAGACAAAACCAGG + Intronic
1187735941 X:22303738-22303760 GGTGGCAGCCAGCCATATGCAGG + Intergenic
1189532664 X:41902373-41902395 GGAGGAAGAGGGCCACAAACCGG - Intronic
1192739525 X:73879523-73879545 GGAGGTAGACAGCCAGATACAGG + Intergenic
1194599602 X:95903988-95904010 AGTGATAGACAGGCACAAACAGG + Intergenic
1195467179 X:105192316-105192338 GGTGTCAGAAAGTCACAAAAGGG - Intronic
1200932324 Y:8708276-8708298 GGTGGGAGACAGCAACTAAGGGG + Intergenic
1201068852 Y:10126093-10126115 GGTGGCCCAGAGGCACAAACTGG - Intergenic
1201520686 Y:14870367-14870389 GGTTGCAGGTAGCCTCAAACTGG - Intergenic