ID: 1162222753

View in Genome Browser
Species Human (GRCh38)
Location 19:9192127-9192149
Sequence TCTGCCATGCAGCTGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162222753_1162222757 25 Left 1162222753 19:9192127-9192149 CCCTGCAGCAGCTGCATGGCAGA No data
Right 1162222757 19:9192175-9192197 TCGGTTCCATTCTTTAGCATGGG No data
1162222753_1162222758 29 Left 1162222753 19:9192127-9192149 CCCTGCAGCAGCTGCATGGCAGA No data
Right 1162222758 19:9192179-9192201 TTCCATTCTTTAGCATGGGTTGG No data
1162222753_1162222756 24 Left 1162222753 19:9192127-9192149 CCCTGCAGCAGCTGCATGGCAGA No data
Right 1162222756 19:9192174-9192196 ATCGGTTCCATTCTTTAGCATGG No data
1162222753_1162222755 6 Left 1162222753 19:9192127-9192149 CCCTGCAGCAGCTGCATGGCAGA No data
Right 1162222755 19:9192156-9192178 TAATCTCATGATCTTATTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162222753 Original CRISPR TCTGCCATGCAGCTGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr