ID: 1162224172

View in Genome Browser
Species Human (GRCh38)
Location 19:9205884-9205906
Sequence CAGGCCTGCCTGCAGTTATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162224169_1162224172 6 Left 1162224169 19:9205855-9205877 CCACCTCTTGTGGAGGGTCTGAC No data
Right 1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG No data
1162224168_1162224172 9 Left 1162224168 19:9205852-9205874 CCTCCACCTCTTGTGGAGGGTCT No data
Right 1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG No data
1162224170_1162224172 3 Left 1162224170 19:9205858-9205880 CCTCTTGTGGAGGGTCTGACATC No data
Right 1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162224172 Original CRISPR CAGGCCTGCCTGCAGTTATG CGG Intergenic
No off target data available for this crispr