ID: 1162225856

View in Genome Browser
Species Human (GRCh38)
Location 19:9221599-9221621
Sequence CCCAGCACTTTGAGAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162225856_1162225860 4 Left 1162225856 19:9221599-9221621 CCTCTGCCTCTCAAAGTGCTGGG No data
Right 1162225860 19:9221626-9221648 CAGGCGTGAGCCACCGCGCCAGG No data
1162225856_1162225864 30 Left 1162225856 19:9221599-9221621 CCTCTGCCTCTCAAAGTGCTGGG No data
Right 1162225864 19:9221652-9221674 TCTTTTGCCCATTTTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162225856 Original CRISPR CCCAGCACTTTGAGAGGCAG AGG (reversed) Intergenic