ID: 1162225858

View in Genome Browser
Species Human (GRCh38)
Location 19:9221605-9221627
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162225858_1162225864 24 Left 1162225858 19:9221605-9221627 CCTCTCAAAGTGCTGGGATTACA No data
Right 1162225864 19:9221652-9221674 TCTTTTGCCCATTTTAAAATTGG No data
1162225858_1162225865 25 Left 1162225858 19:9221605-9221627 CCTCTCAAAGTGCTGGGATTACA No data
Right 1162225865 19:9221653-9221675 CTTTTGCCCATTTTAAAATTGGG No data
1162225858_1162225860 -2 Left 1162225858 19:9221605-9221627 CCTCTCAAAGTGCTGGGATTACA No data
Right 1162225860 19:9221626-9221648 CAGGCGTGAGCCACCGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162225858 Original CRISPR TGTAATCCCAGCACTTTGAG AGG (reversed) Intergenic