ID: 1162225861

View in Genome Browser
Species Human (GRCh38)
Location 19:9221636-9221658
Sequence CAAAAGACAGCCTGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162225861_1162225865 -6 Left 1162225861 19:9221636-9221658 CCACCGCGCCAGGCTGTCTTTTG No data
Right 1162225865 19:9221653-9221675 CTTTTGCCCATTTTAAAATTGGG 0: 29
1: 231
2: 756
3: 1678
4: 3628
1162225861_1162225864 -7 Left 1162225861 19:9221636-9221658 CCACCGCGCCAGGCTGTCTTTTG No data
Right 1162225864 19:9221652-9221674 TCTTTTGCCCATTTTAAAATTGG 0: 50
1: 323
2: 1084
3: 2594
4: 6453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162225861 Original CRISPR CAAAAGACAGCCTGGCGCGG TGG (reversed) Intergenic
No off target data available for this crispr