ID: 1162225861

View in Genome Browser
Species Human (GRCh38)
Location 19:9221636-9221658
Sequence CAAAAGACAGCCTGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162225861_1162225865 -6 Left 1162225861 19:9221636-9221658 CCACCGCGCCAGGCTGTCTTTTG No data
Right 1162225865 19:9221653-9221675 CTTTTGCCCATTTTAAAATTGGG No data
1162225861_1162225864 -7 Left 1162225861 19:9221636-9221658 CCACCGCGCCAGGCTGTCTTTTG No data
Right 1162225864 19:9221652-9221674 TCTTTTGCCCATTTTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162225861 Original CRISPR CAAAAGACAGCCTGGCGCGG TGG (reversed) Intergenic