ID: 1162225862

View in Genome Browser
Species Human (GRCh38)
Location 19:9221639-9221661
Sequence GGGCAAAAGACAGCCTGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162225862_1162225864 -10 Left 1162225862 19:9221639-9221661 CCGCGCCAGGCTGTCTTTTGCCC No data
Right 1162225864 19:9221652-9221674 TCTTTTGCCCATTTTAAAATTGG No data
1162225862_1162225865 -9 Left 1162225862 19:9221639-9221661 CCGCGCCAGGCTGTCTTTTGCCC No data
Right 1162225865 19:9221653-9221675 CTTTTGCCCATTTTAAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162225862 Original CRISPR GGGCAAAAGACAGCCTGGCG CGG (reversed) Intergenic