ID: 1162225865

View in Genome Browser
Species Human (GRCh38)
Location 19:9221653-9221675
Sequence CTTTTGCCCATTTTAAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162225861_1162225865 -6 Left 1162225861 19:9221636-9221658 CCACCGCGCCAGGCTGTCTTTTG No data
Right 1162225865 19:9221653-9221675 CTTTTGCCCATTTTAAAATTGGG No data
1162225862_1162225865 -9 Left 1162225862 19:9221639-9221661 CCGCGCCAGGCTGTCTTTTGCCC No data
Right 1162225865 19:9221653-9221675 CTTTTGCCCATTTTAAAATTGGG No data
1162225858_1162225865 25 Left 1162225858 19:9221605-9221627 CCTCTCAAAGTGCTGGGATTACA No data
Right 1162225865 19:9221653-9221675 CTTTTGCCCATTTTAAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162225865 Original CRISPR CTTTTGCCCATTTTAAAATT GGG Intergenic