ID: 1162225895

View in Genome Browser
Species Human (GRCh38)
Location 19:9222082-9222104
Sequence GGTGCCAAAGACTCACAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162225895_1162225899 -4 Left 1162225895 19:9222082-9222104 CCCCCTTGTGAGTCTTTGGCACC No data
Right 1162225899 19:9222101-9222123 CACCTTTGTTGAAAATCAGTTGG 0: 47
1: 131
2: 421
3: 1215
4: 2849
1162225895_1162225902 24 Left 1162225895 19:9222082-9222104 CCCCCTTGTGAGTCTTTGGCACC No data
Right 1162225902 19:9222129-9222151 AATACATGGATTTATTTCTGTGG No data
1162225895_1162225901 10 Left 1162225895 19:9222082-9222104 CCCCCTTGTGAGTCTTTGGCACC No data
Right 1162225901 19:9222115-9222137 ATCAGTTGGCTATAAATACATGG 0: 14
1: 48
2: 196
3: 690
4: 2187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162225895 Original CRISPR GGTGCCAAAGACTCACAAGG GGG (reversed) Intergenic
No off target data available for this crispr