ID: 1162228425

View in Genome Browser
Species Human (GRCh38)
Location 19:9244095-9244117
Sequence CTGTCTGTCTTTATTTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162228424_1162228425 11 Left 1162228424 19:9244061-9244083 CCAGACTGTGATTCTCACTGGCA No data
Right 1162228425 19:9244095-9244117 CTGTCTGTCTTTATTTGATCAGG No data
1162228422_1162228425 16 Left 1162228422 19:9244056-9244078 CCTCTCCAGACTGTGATTCTCAC No data
Right 1162228425 19:9244095-9244117 CTGTCTGTCTTTATTTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162228425 Original CRISPR CTGTCTGTCTTTATTTGATC AGG Intergenic
No off target data available for this crispr