ID: 1162229779 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:9256542-9256564 |
| Sequence | ACATCCTTCTAGAATAGTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1162229779_1162229781 | -4 | Left | 1162229779 | 19:9256542-9256564 | CCATCACTATTCTAGAAGGATGT | No data | ||
| Right | 1162229781 | 19:9256561-9256583 | ATGTTACTTCTAACATCACAGGG | No data | ||||
| 1162229779_1162229780 | -5 | Left | 1162229779 | 19:9256542-9256564 | CCATCACTATTCTAGAAGGATGT | No data | ||
| Right | 1162229780 | 19:9256560-9256582 | GATGTTACTTCTAACATCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1162229779 | Original CRISPR | ACATCCTTCTAGAATAGTGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||