ID: 1162229779

View in Genome Browser
Species Human (GRCh38)
Location 19:9256542-9256564
Sequence ACATCCTTCTAGAATAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162229779_1162229781 -4 Left 1162229779 19:9256542-9256564 CCATCACTATTCTAGAAGGATGT No data
Right 1162229781 19:9256561-9256583 ATGTTACTTCTAACATCACAGGG No data
1162229779_1162229780 -5 Left 1162229779 19:9256542-9256564 CCATCACTATTCTAGAAGGATGT No data
Right 1162229780 19:9256560-9256582 GATGTTACTTCTAACATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162229779 Original CRISPR ACATCCTTCTAGAATAGTGA TGG (reversed) Intergenic
No off target data available for this crispr