ID: 1162229780

View in Genome Browser
Species Human (GRCh38)
Location 19:9256560-9256582
Sequence GATGTTACTTCTAACATCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162229779_1162229780 -5 Left 1162229779 19:9256542-9256564 CCATCACTATTCTAGAAGGATGT No data
Right 1162229780 19:9256560-9256582 GATGTTACTTCTAACATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162229780 Original CRISPR GATGTTACTTCTAACATCAC AGG Intergenic
No off target data available for this crispr