ID: 1162234572

View in Genome Browser
Species Human (GRCh38)
Location 19:9297894-9297916
Sequence CTTATCCAGGGCATCTTTAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162234572_1162234576 -1 Left 1162234572 19:9297894-9297916 CCCATAAAGATGCCCTGGATAAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1162234576 19:9297916-9297938 GTTCTCTCTTCACTGTCTGCAGG 0: 1
1: 0
2: 3
3: 17
4: 270
1162234572_1162234577 20 Left 1162234572 19:9297894-9297916 CCCATAAAGATGCCCTGGATAAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1162234577 19:9297937-9297959 GGTCCTCCTCTTGTTCCCACTGG 0: 1
1: 0
2: 1
3: 11
4: 153
1162234572_1162234578 21 Left 1162234572 19:9297894-9297916 CCCATAAAGATGCCCTGGATAAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1162234578 19:9297938-9297960 GTCCTCCTCTTGTTCCCACTGGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162234572 Original CRISPR CTTATCCAGGGCATCTTTAT GGG (reversed) Exonic
901329185 1:8391510-8391532 CTTCTCCAGGGCCTCTGTACAGG + Intronic
904260461 1:29284790-29284812 CTTATCCTGGGCATCTGTGCAGG + Exonic
906806454 1:48783427-48783449 CTTATCCAGGTGATGTTCATTGG - Intronic
906919276 1:50047200-50047222 CTTATCCAGTGTCTCTTTATAGG - Intergenic
909994873 1:82267020-82267042 CTTTTCCAAGGTATCTCTATGGG + Intergenic
910916585 1:92296140-92296162 TCTCTCCAGGGCATCTTGATTGG - Intronic
914744461 1:150491534-150491556 CTCTTCCAGGACATCTTTGTGGG + Intronic
916453800 1:164949341-164949363 TTTCTCCAGGGCATCTTTTGTGG + Intergenic
916696438 1:167241998-167242020 CTTAACCAAGGCATTTTTTTAGG - Intronic
918777510 1:188653283-188653305 TTTATACAGGGCATCTGAATGGG - Intergenic
918861680 1:189834973-189834995 CTTGTATAGGGCATCTTTACGGG + Intergenic
919042949 1:192414937-192414959 CTTAAGCAAGGCATATTTATAGG - Intergenic
919376760 1:196804705-196804727 CTTACCTAGTTCATCTTTATTGG - Intergenic
921866992 1:220096438-220096460 CTTATTCAGTGCATAATTATCGG + Intronic
922517990 1:226223001-226223023 CCTACCTAGGGTATCTTTATTGG + Intergenic
922590663 1:226773455-226773477 CTTCTCTAGAGCATATTTATAGG - Intergenic
922923856 1:229331048-229331070 CTTTTCCAGGTCATCCTTAGTGG - Intronic
1063579671 10:7294245-7294267 CTCACCCAGTGCATCTGTATGGG + Intronic
1068148564 10:53102152-53102174 CTTTTCCAGGACATTTTTAAGGG + Intergenic
1069673010 10:70225740-70225762 CTTTTCGAAAGCATCTTTATGGG - Intronic
1077518764 11:3018627-3018649 CTTTTTCAAGGCATCTTTAATGG + Exonic
1077825178 11:5800305-5800327 CTTATACAGGACAACTTTATTGG + Intronic
1078344207 11:10529939-10529961 CTAACCCAGGGAATCTTTATGGG + Intronic
1079579117 11:22040141-22040163 CTTCTCCAGTGCAGTTTTATAGG - Intergenic
1080385459 11:31808420-31808442 CCTATCCAGGGCATGGCTATGGG - Intronic
1080882802 11:36338613-36338635 CTTATGTAGGGAATATTTATTGG + Intronic
1090667756 11:128926062-128926084 CCTTTCCAGGCCATCTTTTTAGG + Intergenic
1095287107 12:40426000-40426022 CTTATCCAAACCATCTTTAAAGG - Intronic
1095555661 12:43500925-43500947 CTTAGCAAGGGCATATCTATAGG - Intronic
1097970052 12:65623882-65623904 CATATGCAGGGCATATTCATGGG - Intergenic
1098338793 12:69430628-69430650 CTGACCCTGGCCATCTTTATGGG + Intergenic
1102792770 12:115661172-115661194 CAATTCCAGGGCATATTTATAGG - Intergenic
1106193356 13:27473217-27473239 TTTAACCCGGGCTTCTTTATTGG + Intergenic
1112285497 13:98100593-98100615 CACATCCAGGGCCTCTATATGGG - Intergenic
1112599974 13:100845614-100845636 CTTATTCAGTACATTTTTATTGG - Intergenic
1116128042 14:40814339-40814361 GTTAGCCAGGGCAGCTTAATGGG - Intergenic
1117595391 14:57321840-57321862 CCTTTCCAGGTCATCTTGATTGG - Intergenic
1121694454 14:95901444-95901466 CTTATTCCTGGCATCTATATGGG - Intergenic
1122055843 14:99097784-99097806 CTTAGCCCGGACATCTATATGGG + Intergenic
1128803088 15:70509575-70509597 CTTACCCAGGGCTTCCTCATAGG + Intergenic
1134294285 16:12931673-12931695 TTTATCCAGTCCATGTTTATTGG + Intronic
1137977849 16:53046149-53046171 CTCAAACAGGGCATCTTAATTGG - Intergenic
1138316501 16:56074381-56074403 CTAATCCAGTGCAGCTTTATAGG - Intergenic
1138686152 16:58727622-58727644 CCTACCCAGGGCATTATTATGGG + Intronic
1138884907 16:61064874-61064896 TTTATCCAGTCCATCATTATGGG - Intergenic
1139390437 16:66604244-66604266 CTCCTCCAGGGCCTCTTTGTTGG - Exonic
1140810440 16:78572074-78572096 TTTCTCTAAGGCATCTTTATAGG - Intronic
1145825210 17:27871790-27871812 ATTTTCCTGGGCATCTTTTTTGG - Intronic
1150914849 17:69426001-69426023 CTTATCCAAGTCCTCTTTTTAGG - Intronic
1151249209 17:72820723-72820745 CAGCTCCAGGGCATCTTTACGGG - Intronic
1156494933 18:37519426-37519448 CTTCTGCAGGTCATCTTTCTTGG + Intronic
1160052367 18:75446924-75446946 CATATCCAGGTCATAATTATGGG + Intergenic
1162234572 19:9297894-9297916 CTTATCCAGGGCATCTTTATGGG - Exonic
931360711 2:61575421-61575443 CTTAGCCTGGGCCTCTTTACAGG - Intergenic
933379246 2:81522077-81522099 CTTAGCCAGGGCCACTTCATAGG - Intergenic
934029157 2:88026075-88026097 GTTATCCAAGGCATTTTTAGAGG + Intergenic
938810813 2:134851195-134851217 TTTATCCAGTTCATCGTTATGGG + Intronic
941303717 2:163834396-163834418 CTTAACCAGGCCTTCTGTATTGG - Intergenic
942707129 2:178787272-178787294 TTTATCCAGGGCTTCCTTTTAGG + Intronic
944798749 2:203215044-203215066 CTTTTCCAGGGTATATTTATTGG - Intronic
945632345 2:212296287-212296309 ATTATCCCAGGCATATTTATTGG - Intronic
1169078362 20:2777107-2777129 CTTATCAATGGTATTTTTATGGG - Intergenic
1174881330 20:54282413-54282435 CTTATTCAAGACATATTTATTGG - Intergenic
1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG + Intergenic
958898388 3:99856214-99856236 CTTATCAAGTGCATCTTCCTGGG - Intronic
963600310 3:147372765-147372787 CTTCTCCAGTCCATCTTTAAAGG - Intergenic
967300212 3:188005159-188005181 CTGATTCAGGCCATCTTTTTTGG + Intergenic
969274817 4:6128044-6128066 CCTTTACAGGGCATCTTTGTAGG - Intronic
976962738 4:90999116-90999138 TTTATCCAGGCCATCGTTGTTGG + Intronic
979053270 4:115963404-115963426 CTAATCCTGGGCATATTTTTTGG + Intergenic
981845671 4:149165360-149165382 CTTATCGAATGCATCTTTTTAGG + Intergenic
985986735 5:3522367-3522389 TTTGTCCAGGGCTTCTTGATGGG + Intergenic
987246692 5:16056235-16056257 CATAACCAGGACATCTTTGTGGG - Intergenic
998144189 5:139716890-139716912 CTTAGCCAGGGCTCTTTTATAGG - Intergenic
999900885 5:156085795-156085817 GTGATCCAGGGTTTCTTTATGGG + Intronic
999975716 5:156910038-156910060 CGGATCCATGCCATCTTTATGGG - Intergenic
1000368762 5:160515302-160515324 CTTAGCCAGGGCATCTTGGAAGG + Intergenic
1000763253 5:165252740-165252762 CTTACCCAGGTCACCTTCATAGG + Intergenic
1000910364 5:167014439-167014461 CTTAAACAGGACTTCTTTATTGG - Intergenic
1005789394 6:29281697-29281719 CTGATCCTGGGCTTCTTTTTTGG + Intergenic
1006188996 6:32196327-32196349 GTTGTCCTGGGCATCTTTATCGG + Exonic
1006310214 6:33252135-33252157 CTTAACCAGGGGAACTGTATGGG - Intronic
1007989205 6:46237836-46237858 CTTAACGTGGGCCTCTTTATGGG - Intronic
1008560265 6:52717222-52717244 CTTATTCAGGCCATCTTTCTGGG - Intergenic
1010108642 6:72197880-72197902 CTTTTCCTTGGCATCTTTAATGG - Intronic
1016077149 6:139809647-139809669 TTTATCCAGTCCATCGTTATGGG - Intergenic
1021401399 7:20213531-20213553 TTTATCCAGTCCATCATTATGGG - Intronic
1021818969 7:24477970-24477992 CTAATGCAGGGCCTCTTTCTGGG - Intergenic
1022268795 7:28785711-28785733 CAGATCCAGGGCTTCTTAATGGG + Intronic
1022817240 7:33925174-33925196 CTTATTCAGTGCATATTTGTTGG + Intronic
1023438509 7:40162910-40162932 CTGATGCCTGGCATCTTTATTGG + Intronic
1027967342 7:85028872-85028894 CTTCTCCAAGGCATCTTCAATGG + Intronic
1027999401 7:85472355-85472377 CTAATCCATGGCATTTTTCTAGG - Intergenic
1028607700 7:92673104-92673126 GTCAACCAGGGCATCTTCATGGG - Intronic
1030749977 7:113219764-113219786 CTTATCCAGTGCAATTCTATGGG - Intergenic
1030757364 7:113303647-113303669 TTTATCCAGTGTATCATTATTGG + Intergenic
1031255062 7:119436402-119436424 CATATCCATGTTATCTTTATAGG + Intergenic
1032882634 7:136105410-136105432 TTTATCCAGGCCATCTTTGATGG + Intergenic
1033345022 7:140519832-140519854 CTGATTCAGAGCATGTTTATAGG - Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035584762 8:763463-763485 CTTATCAATGGCATCTTGAATGG + Intergenic
1037095932 8:14987664-14987686 TTGATCCTGGGCATCTTTACTGG + Intronic
1043065407 8:75564182-75564204 CTTAGCCAAGGCTTCTTCATTGG + Exonic
1048090099 8:131231268-131231290 CATATCCAGTGCATATTTATGGG + Intergenic
1048960336 8:139571496-139571518 CATATCCAAGGCATATTTGTTGG + Intergenic
1050169315 9:2798903-2798925 ATCATCCAGGGCATCATCATCGG + Intronic
1194307988 X:92272132-92272154 TTTATCAAGGGCATTTATATTGG + Intronic
1194919146 X:99743146-99743168 TTTATCCAGAGCCTTTTTATGGG + Intergenic
1195928984 X:110054410-110054432 CTTATCCAGGAAATCTCTAGAGG + Intronic
1199762555 X:150916301-150916323 TTTATCCAGAGGATCTTTACAGG + Intergenic
1200976850 Y:9220542-9220564 CTAATCCAGGGTGTGTTTATTGG + Intergenic