ID: 1162239075

View in Genome Browser
Species Human (GRCh38)
Location 19:9333700-9333722
Sequence CTTATTCTCAGGCTTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162239075_1162239079 19 Left 1162239075 19:9333700-9333722 CCAGAAACAAGCCTGAGAATAAG 0: 1
1: 0
2: 1
3: 25
4: 178
Right 1162239079 19:9333742-9333764 TGTAACTGACAAAAAAAAAAAGG 0: 1
1: 0
2: 13
3: 163
4: 1597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162239075 Original CRISPR CTTATTCTCAGGCTTGTTTC TGG (reversed) Intronic
903019521 1:20384335-20384357 AGGATTCTCAGGCTTGTTCCAGG - Intergenic
903304141 1:22400902-22400924 CTGCTTCTCAGGCTCCTTTCTGG - Intergenic
906033506 1:42737401-42737423 CTTATTCTCAAGTTTCTTCCTGG + Intronic
906520009 1:46461291-46461313 CTTCTCCTCAGGCTTGACTCGGG - Intergenic
911121710 1:94302933-94302955 CTCTTTGTCAGGCTCGTTTCCGG + Intergenic
911870205 1:103087621-103087643 CATGTTCTCTGGCTTGCTTCTGG + Intronic
912375568 1:109207084-109207106 CTTCTGCTCAGGTTTCTTTCAGG + Intergenic
914387129 1:147180589-147180611 CTTATTTTAAGGCTCTTTTCAGG - Intronic
918460207 1:184768469-184768491 CTTATTCTGAGCCTTTTTTCTGG - Intergenic
918918671 1:190675666-190675688 TTTATTCTCATGCTTTTTTCTGG + Intergenic
921198762 1:212783514-212783536 CTCAGTTTCAGGATTGTTTCAGG - Intronic
923109747 1:230881244-230881266 CTTATGCTCATTGTTGTTTCTGG - Intergenic
923696403 1:236256291-236256313 CTTCTTCCCTGGCTTGCTTCAGG + Intronic
1063799734 10:9560933-9560955 TTTGTTCTCAGGCTAGTTTCAGG - Intergenic
1063888207 10:10601190-10601212 ATTATTCTCAGGATTATTGCAGG - Intergenic
1065024731 10:21529335-21529357 CATATTCTTGGGCTTGTTTCTGG + Intergenic
1069022654 10:63505850-63505872 CTTTATCTCAGGCCTGTTTCAGG - Intergenic
1069837100 10:71316430-71316452 CTCAATCTCAAGATTGTTTCAGG + Intergenic
1070696204 10:78565211-78565233 CTTATTCTCATGGTGGTCTCAGG - Intergenic
1073093783 10:100967883-100967905 CTTATGCACAGGCTTGTGTTGGG - Intergenic
1073903050 10:108245426-108245448 CTTTTTCTCTCCCTTGTTTCAGG + Intergenic
1073975879 10:109100534-109100556 GTTATTCTAATGCTTGTTTTAGG + Intergenic
1074351835 10:112745379-112745401 TTTTTTCTCAGACTAGTTTCTGG + Intronic
1075758527 10:124836792-124836814 GTTTTTGTCAGGCTGGTTTCAGG + Intergenic
1075992430 10:126849344-126849366 CTCATCTTCAGGCTGGTTTCTGG + Intergenic
1078918611 11:15805331-15805353 CTTCTTCTCAGGATTGTTTGAGG + Intergenic
1079348620 11:19674234-19674256 GTTATTCTCAGGCCAGTCTCGGG - Intronic
1079611018 11:22432694-22432716 CTTATTCTTTGGCTTCTTCCCGG + Intergenic
1080956058 11:37097251-37097273 TTTATTCTCAAGTTTTTTTCAGG + Intergenic
1081291928 11:41337010-41337032 TTTTTTATGAGGCTTGTTTCTGG - Intronic
1083575269 11:63786070-63786092 CTTCTCCTCTGGCTTCTTTCTGG - Intergenic
1084901057 11:72310315-72310337 CTTTTTCTCAGGCCTCTTTCAGG - Intronic
1088329020 11:108630316-108630338 TTACTTCTCAGGCTTATTTCTGG - Intergenic
1089030001 11:115316073-115316095 ATTATTCTCAGGCATGTTCATGG - Intronic
1089062718 11:115639243-115639265 CTGTTTCTCAGCCTTGTCTCTGG - Intergenic
1090145929 11:124322527-124322549 CTTATTCTCAATCTTGTTCATGG + Intergenic
1090947441 11:131443853-131443875 CTTATTCACATGCTTCTTACAGG - Intronic
1091330718 11:134729096-134729118 CTGATTCCCAGGCTGCTTTCTGG + Intergenic
1092921501 12:13235808-13235830 CTTCTTCTGAGGCATTTTTCTGG - Intergenic
1096479210 12:51926711-51926733 TTTAGTCTCAAGCTTGTTACTGG + Intergenic
1098931008 12:76413874-76413896 CTTATTCTGTGGCTTTTTACAGG + Intronic
1099474634 12:83093548-83093570 CTTATTGTTGGGTTTGTTTCTGG + Intronic
1099790081 12:87322572-87322594 CTTATTCCCATGGTAGTTTCAGG - Intergenic
1102006375 12:109591533-109591555 CTTATTTTCAGGCCTCTTCCTGG + Intronic
1103015385 12:117490396-117490418 CTTATCCTTAGGCTAGTGTCTGG - Intronic
1103527267 12:121577255-121577277 CTTTTTCTCAGGCTGATTTGAGG - Intronic
1106118828 13:26840525-26840547 CCTATTATCAGCCTTTTTTCAGG + Intergenic
1109177464 13:59173982-59174004 CTTTTTCTCCTGCTTCTTTCTGG + Intergenic
1109529946 13:63629603-63629625 GTTACTCTCAGGCTTTTTACTGG - Intergenic
1109945380 13:69424681-69424703 CTTATTACCAGAATTGTTTCTGG - Intergenic
1111700690 13:91684150-91684172 CTTATTCTAATTCTTGTTGCTGG + Intronic
1113030177 13:105984540-105984562 CTTTTGCTCAGGCTTGTTTCAGG - Intergenic
1113719398 13:112542552-112542574 CTTATTTTTAGGTCTGTTTCTGG - Intronic
1113827413 13:113267630-113267652 CTTATCCGAAGGCTTGTTGCTGG - Intergenic
1115159573 14:30378286-30378308 GTGAATCTCAGGATTGTTTCTGG + Intergenic
1116528168 14:45933439-45933461 CTTTTTCTCTGGCTGCTTTCAGG - Intergenic
1119835993 14:77749387-77749409 ACTTTTTTCAGGCTTGTTTCAGG - Intronic
1119996168 14:79256017-79256039 CTTCATCTCAGGATTGCTTCAGG + Intronic
1120540051 14:85740354-85740376 CTTCTTATCAGGATTGTTTTAGG - Intergenic
1121394854 14:93611930-93611952 CTTCTTATCAGGTTTGGTTCAGG - Intronic
1128065037 15:64759225-64759247 CCCATCCTCAGCCTTGTTTCTGG + Intronic
1129177408 15:73849786-73849808 CTCATTCTCAGGCTTGTGACTGG - Intergenic
1134248122 16:12555127-12555149 CTTATTCTCAGACTTGGTCCAGG + Intronic
1134248216 16:12555662-12555684 CTTATTCTCAGACTTCGTGCAGG - Intronic
1137063884 16:35816375-35816397 TTTTTTCTCTTGCTTGTTTCTGG + Intergenic
1138808398 16:60120425-60120447 ATTATACTCAGGCTAGTTTTAGG + Intergenic
1140502918 16:75450547-75450569 ATTATTTTCAGGCTTGTTTTTGG - Intronic
1148946581 17:51267728-51267750 CTTTTTCTCAGCTTTGTGTCAGG + Intronic
1149517858 17:57293976-57293998 CTTTTTCTGAGGCTTGTTCAGGG + Intronic
1149592893 17:57845428-57845450 CTTATTCTTACTGTTGTTTCAGG - Intronic
1150821678 17:68439655-68439677 TTTATTTTAAGGCATGTTTCAGG + Intronic
1152026674 17:77814165-77814187 CTTCTTCTCAAGGTAGTTTCAGG - Intergenic
1153235586 18:2983893-2983915 CTTGTTCTCAAGATTGTCTCGGG - Intronic
1155461210 18:26085955-26085977 TTTATTCTCACCCTTGTTTTGGG - Intronic
1156197839 18:34795784-34795806 CTTATTGTTAGTCTGGTTTCTGG - Intronic
1157071271 18:44411649-44411671 CTTAATTTCAGACTTGTTTTAGG - Intergenic
1157090308 18:44628957-44628979 CTTCTTCTCAGGCTTGTCACAGG + Intergenic
1162239075 19:9333700-9333722 CTTATTCTCAGGCTTGTTTCTGG - Intronic
1164544325 19:29146770-29146792 CTGATTCTCAGCCATGTTCCAGG - Intergenic
1164982162 19:32622208-32622230 GTTTTTCTCAGGGTTGTTCCAGG - Intronic
1165616115 19:37202410-37202432 ATTATTCTCAACCTTGTTTCAGG - Intronic
1167975125 19:53220226-53220248 TTTATTCTTAGGCTTATTGCAGG + Intergenic
924961048 2:34979-35001 TTTCTTCTCAGGGTTCTTTCAGG + Intergenic
926378709 2:12262349-12262371 CTTATTCCCAGGCTTTTTCTAGG + Intergenic
927184773 2:20474211-20474233 CTAATCCTCAGGCCTGTGTCTGG + Intergenic
927254295 2:21026578-21026600 CTTATTGTGAGTCTGGTTTCTGG + Intronic
927803366 2:26122061-26122083 CTGTTTCTCAGGATTGCTTCTGG - Intronic
928102131 2:28444987-28445009 CTTATTCTCAGCCCTGTGTTTGG + Intergenic
928513545 2:32023730-32023752 ATTTTTCTCAGCATTGTTTCTGG - Intronic
930328290 2:49948510-49948532 TTTATTCTCAAGATTGTTGCTGG - Intronic
931344397 2:61432895-61432917 CTTATTTTCACCCTTGTTTCTGG - Intronic
931534449 2:63257579-63257601 CCTTTTCTCAGCCTTGTCTCAGG - Intronic
932010762 2:67975321-67975343 CTGATTCTGAGGCTGTTTTCTGG + Intergenic
932408103 2:71527401-71527423 CTTATTTACAGGCTTTCTTCAGG - Intronic
932885431 2:75545276-75545298 TTTATTCTCAAGCTTGTATCTGG - Intronic
935181916 2:100699334-100699356 CTCAGTGCCAGGCTTGTTTCAGG - Intergenic
935333812 2:101997038-101997060 CCTCTTCTCAGGCTTCTTCCTGG - Intronic
935431283 2:102978631-102978653 CTTGCTCTCAGTCTTGTTTGTGG - Intergenic
942555724 2:177170704-177170726 CGTATACAAAGGCTTGTTTCTGG - Intergenic
943061082 2:183042082-183042104 ATAATTCTCATGCTAGTTTCTGG - Intergenic
943582919 2:189705587-189705609 CCTAGTCTCAGGCTTCTTCCAGG - Intronic
943888435 2:193253476-193253498 CTTTTCCTCAAGATTGTTTCAGG + Intergenic
945609974 2:211988087-211988109 TTTATTATCAGGCTTGATTAAGG + Intronic
946003865 2:216506360-216506382 CTTAGTCTCTGGCTTACTTCAGG + Intronic
946941400 2:224773584-224773606 CTCATTCTCAGGGCTGTTTTAGG + Intronic
947144705 2:227054219-227054241 GTTATTATCAGGCTTTTTACAGG + Intronic
947304008 2:228723166-228723188 GTAATTTTCAGCCTTGTTTCAGG + Intergenic
947855122 2:233318809-233318831 CCTTGTCTCAGGCTGGTTTCTGG + Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169531994 20:6495353-6495375 CTTTTTCACAGGCAAGTTTCAGG + Intergenic
1169598285 20:7226172-7226194 CTTGTCCTCAGGCTTGTTGGAGG + Intergenic
1172658878 20:36553520-36553542 CTGATTCTCTGTTTTGTTTCTGG - Intergenic
1173040314 20:39456039-39456061 GATATGCTCAGGCTTGTCTCTGG + Intergenic
1174918869 20:54681284-54681306 ATTATTCTAAGGATTGTCTCTGG + Intergenic
1183144099 22:35973500-35973522 CTTGACCTCAGGCTGGTTTCTGG + Intronic
1185155197 22:49189432-49189454 CCCATTCACAGGCTTGTTTAAGG + Intergenic
949150289 3:758554-758576 CTCATTCTCATTCTGGTTTCAGG - Intergenic
949336456 3:2980557-2980579 TTTATTTTCATGTTTGTTTCTGG - Intronic
950965050 3:17140192-17140214 CTTATTCTGGGGCATGCTTCTGG + Intergenic
951410954 3:22366063-22366085 CTTATTCTTTACCTTGTTTCAGG + Intronic
951945414 3:28130427-28130449 TTTCTTCTCAGGAATGTTTCTGG + Intergenic
956215102 3:66840637-66840659 CTGAATCTCAGGCCTGTTTGAGG + Intergenic
959047064 3:101485664-101485686 CATATTATCAGAGTTGTTTCTGG - Intronic
959827784 3:110819883-110819905 CTATTTCTCAGGTTTCTTTCTGG - Intergenic
960266024 3:115622037-115622059 CTTATTGTTAGGCATATTTCAGG - Intergenic
960299799 3:115988368-115988390 CTGTTTCTCAAGCTTGCTTCTGG + Intronic
961482643 3:127193903-127193925 CTTATTCTGTGGCTTGCTTGTGG + Intronic
961796724 3:129414426-129414448 CTTAATCTCATGCATGTTTGGGG - Intronic
962295460 3:134180110-134180132 CTAATTCTCAGTCTTGTTGAGGG + Intronic
962360006 3:134731863-134731885 CTTATTGTCAAACTTTTTTCTGG - Intronic
962696025 3:137948214-137948236 CTGCTTCTCAGGCTTGTTGTTGG - Intergenic
963489952 3:145987268-145987290 CTTGGTCTAAGGCTTTTTTCTGG - Intergenic
967381193 3:188860226-188860248 CTTATTCTCTACCTTGATTCTGG - Intronic
967604676 3:191431474-191431496 CTCATTCTCAGTCTTGATTCTGG - Intergenic
968255259 3:197263941-197263963 CTAATTTTCAGGATTGTTTCAGG - Intronic
968885052 4:3324441-3324463 CTTCTTCTCTTGCTTGTCTCTGG + Intronic
969485260 4:7468742-7468764 CTTATTGTCAGCATTGTTTGGGG + Intronic
970282681 4:14475360-14475382 CTTCTTCTCAGCCTACTTTCAGG + Intergenic
970334948 4:15027431-15027453 CTTATTCTTAGGCTTTTATGAGG + Intronic
971125982 4:23755362-23755384 TTTATCCTAAGCCTTGTTTCAGG + Intronic
972945840 4:44254404-44254426 CTGATTCTCAGGCTTGTAGGAGG + Intronic
974332537 4:60498947-60498969 TTTATACTCTGGCATGTTTCTGG + Intergenic
974480498 4:62437050-62437072 CTTTTTCTCAATCTTATTTCTGG + Intergenic
976204154 4:82608881-82608903 CTTTCTCTCATGCTTGTTTGTGG - Intergenic
977742883 4:100507741-100507763 TTTATTCTCAATCTTTTTTCCGG + Intronic
979341205 4:119526320-119526342 CTTATGATCAGGCTTGTGTGAGG - Intronic
979566778 4:122163136-122163158 CTTTATCCCAGGTTTGTTTCTGG - Intronic
980556602 4:134414533-134414555 TTTATTCTCAGTCTTATTTCTGG - Intergenic
982454862 4:155597057-155597079 CATATTCTCAGTAATGTTTCAGG + Intergenic
982853287 4:160346260-160346282 TTTCTTCTGAGGCTTGTTCCTGG - Intergenic
983491242 4:168392180-168392202 CTTATTCTCATGTTTGTTTATGG + Intronic
984173575 4:176389484-176389506 CCCATTTTCAGACTTGTTTCAGG - Intergenic
987103260 5:14611641-14611663 AGTATTCTCAGGCTAGTTTTTGG + Exonic
987369344 5:17179167-17179189 CTTATTCTCAGGCTGGGTTGGGG + Intronic
987582460 5:19811691-19811713 CTTTCTCTTAGGCTTATTTCAGG - Intronic
987969881 5:24928965-24928987 CTATTTCTAAGGTTTGTTTCTGG - Intergenic
989443896 5:41506366-41506388 CTAATTCTCAGTTTTGTTTTTGG - Intronic
990271474 5:54146028-54146050 CTTATACTCAGTCTTGTTACAGG + Intronic
990970396 5:61499925-61499947 CTATTTCACAGGATTGTTTCAGG - Intronic
994733810 5:103526744-103526766 CTTAATCTCAGGCCTGCTTCTGG - Intergenic
998973417 5:147617530-147617552 ATTATTATCAGGCTTGTTTACGG + Intronic
999732271 5:154483518-154483540 CTCATTCTCAGGCCTGTAACAGG + Intergenic
1001540653 5:172535266-172535288 CCTCTTTTCAGCCTTGTTTCTGG + Intergenic
1002428423 5:179189140-179189162 CTGTGTCTCAGGGTTGTTTCAGG + Intronic
1007862444 6:44926417-44926439 CTTTTTGTCAGGTTTGTTGCAGG - Intronic
1009886534 6:69630059-69630081 ATTATTCTCTGGCTGCTTTCAGG - Intergenic
1011445670 6:87436540-87436562 CTTAGTCCCTAGCTTGTTTCTGG - Intronic
1011576387 6:88805353-88805375 CTTTTTCTCAGGCTTCTATCAGG + Intronic
1011581496 6:88871820-88871842 TTTACTCTCAGTCTTCTTTCTGG - Intronic
1012925698 6:105264987-105265009 CTTTTCCTCTGGCTTATTTCAGG - Intergenic
1017271152 6:152507055-152507077 CTAATTTTCAAGCTTGTCTCTGG + Intronic
1017401518 6:154069821-154069843 GGTCTTCTCAGGCTTTTTTCTGG + Intronic
1021568742 7:22042481-22042503 CTTATTCTCAGATTTCTTTCTGG + Intergenic
1022644170 7:32215513-32215535 CTTACTCTGAGATTTGTTTCTGG - Intronic
1024194448 7:47045350-47045372 CTGCCTCCCAGGCTTGTTTCTGG - Intergenic
1024838343 7:53552028-53552050 CTTCTTCTAAGGCTTATTTTTGG + Intergenic
1026532163 7:71208960-71208982 CTTACTCTCCAGCCTGTTTCAGG - Intronic
1031105724 7:117540160-117540182 CTTCTTCTCAGGGTTCTTTGTGG + Exonic
1031629298 7:124027370-124027392 CCTATTCTTAGGCTTGGTACTGG - Intergenic
1031754222 7:125618077-125618099 CTTACTCTCAGGCTGATTCCTGG + Intergenic
1032280872 7:130500104-130500126 CTTATTCTTAGGATTGGTTTTGG - Intronic
1035608502 8:945320-945342 CTGATTCTGAGAATTGTTTCTGG - Intergenic
1036713148 8:11095398-11095420 CTGATTCTCATGCTTGTCTTAGG - Intronic
1038583192 8:28767966-28767988 CTTATTCCCAGCACTGTTTCAGG - Exonic
1040388035 8:46926865-46926887 CTTGTTTGCAGGCTTGTTCCAGG + Intergenic
1041619258 8:59946461-59946483 ATTTTTCTCATGCTTGTTTTAGG + Intergenic
1042297573 8:67238134-67238156 CTTAGTTTCAGGCTTCTCTCTGG - Intronic
1048815290 8:138328028-138328050 CTTATTATCATTCTTGTCTCGGG + Intronic
1053623805 9:39847498-39847520 CTTTTTTTCAGCCTCGTTTCAGG + Intergenic
1053881063 9:42595730-42595752 CTTTTTTTCAGCCTCGTTTCAGG - Intergenic
1054220092 9:62403201-62403223 CTTTTTTTCAGCCTCGTTTCAGG - Intergenic
1054230623 9:62505971-62505993 CTTTTTTTCAGCCTCGTTTCAGG + Intergenic
1055724273 9:79210853-79210875 CTCCTTCCCAGGCTTGTTGCTGG - Intergenic
1057482882 9:95459596-95459618 TTACTTCTCAGCCTTGTTTCAGG + Exonic
1057972776 9:99573424-99573446 TTTACTCTCAGCCTTGTCTCTGG - Intergenic
1058737033 9:107903172-107903194 TTAATTCTCAGGCCTGTCTCGGG + Intergenic
1058864016 9:109145037-109145059 CCTATTCTGAGGCTTGTGTGGGG - Intronic
1186201586 X:7160408-7160430 CTTATAGACAGCCTTGTTTCAGG - Intergenic
1187049459 X:15681175-15681197 TGTACTCTCAGGCTTATTTCTGG - Intergenic
1187080080 X:15976817-15976839 CTTATTCTCAGGCTTCTTATGGG + Intergenic
1189601190 X:42628294-42628316 CTTGTTCCCAGACTTGTCTCTGG + Intergenic
1191995901 X:67094851-67094873 CTGGTTCTCAGGCTTGTGTGGGG + Intergenic
1194358936 X:92922941-92922963 CTTATTTTCAGACTTGGCTCTGG + Intergenic
1194542076 X:95186450-95186472 CTTTTTCTCAGGATGGTTTTGGG + Intergenic
1198300425 X:135329006-135329028 CATATTCTCATGCTTTTTTGTGG + Intronic