ID: 1162240252

View in Genome Browser
Species Human (GRCh38)
Location 19:9346928-9346950
Sequence CTAGTTCACTACTACTATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162240252 Original CRISPR CTAGTTCACTACTACTATAG AGG Intronic
900827495 1:4938590-4938612 CTATTTCACTACTACTAGTGTGG - Intergenic
911653582 1:100417737-100417759 CTATATCACTACAACTATAGTGG - Intronic
921428324 1:215031709-215031731 CTTGTTCATTACTGGTATAGAGG + Intronic
1068037150 10:51775262-51775284 TTAGTGCACAAATACTATAGCGG + Intronic
1070415707 10:76187421-76187443 CTAGTTCATTACTGCAACAGAGG + Intronic
1070425787 10:76285784-76285806 CTAATACACTAGTACTCTAGAGG - Intronic
1071787043 10:88912738-88912760 CTACTGCACTTCTAATATAGTGG - Intronic
1079615552 11:22488258-22488280 ATTGTTAACTTCTACTATAGTGG + Intergenic
1085821272 11:79796211-79796233 CTATTTCCCTACTTCTATGGTGG + Intergenic
1090694187 11:129220686-129220708 CTAGTTTACTAGTTCTAGAGTGG - Intronic
1091892070 12:4065462-4065484 CTTGTTCATTACTAATATATAGG + Intergenic
1093874127 12:24329132-24329154 TTAGTTCACTACAACAAAAGAGG + Intergenic
1098782975 12:74711202-74711224 CTAGTTTATTACTACAATAAGGG + Intergenic
1100991501 12:100256329-100256351 CTAGTTCAGTAGTAATATAATGG + Intronic
1101175682 12:102149121-102149143 CTATTTAACTACTACTTTATTGG - Intronic
1105025377 12:132845097-132845119 AAAGTGAACTACTACTATAGTGG + Intronic
1107814885 13:44235649-44235671 CAAGTTCACTTCAACAATAGAGG + Intergenic
1107944181 13:45402680-45402702 ATACTTCCCTACTACTATATAGG + Intronic
1109472473 13:62827237-62827259 CTAGCTCACTACTACCACAATGG - Intergenic
1111268279 13:85848837-85848859 CTAGTTCTCTATAACTATAAGGG + Intergenic
1113044386 13:106139770-106139792 ATAGTTCATTATTACTATTGAGG + Intergenic
1121794297 14:96722770-96722792 CTACTTTACAACTTCTATAGGGG + Intergenic
1125167007 15:36718641-36718663 TTTGTTCATTGCTACTATAGAGG + Intronic
1126526565 15:49662692-49662714 CTACTTCCCTTTTACTATAGAGG + Intergenic
1149881981 17:60301386-60301408 CTACTTCACACCTACTAGAGTGG - Intronic
1162240252 19:9346928-9346950 CTAGTTCACTACTACTATAGAGG + Intronic
929289280 2:40170782-40170804 CTAGTACACTATTTCTATAATGG - Intronic
941521987 2:166557022-166557044 CTAGTTAACTACTTTTATTGAGG - Intergenic
946557962 2:220880395-220880417 CTATGTCACTAATACTCTAGAGG + Intergenic
1168834163 20:866204-866226 TTAGTTCACTCATACTAAAGAGG - Intergenic
1170646909 20:18205230-18205252 CTTGTTCATTACTAATATATAGG - Intergenic
1180040737 21:45278119-45278141 CTACTTCACGACCACTATGGAGG - Exonic
957690328 3:83557997-83558019 CTAATTCACTATTATTATGGTGG + Intergenic
970067270 4:12112818-12112840 CTAGTTCACTAGTATTTTTGAGG + Intergenic
974571097 4:63649784-63649806 CTAGTTCTCTACTAATTTATGGG + Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
977237120 4:94521702-94521724 CTAGTTCAGTAGTAATATAAAGG - Intronic
983197368 4:164822438-164822460 CTGGTTCACTACCAGTAGAGGGG + Intergenic
987478658 5:18425080-18425102 CTTGTTCATTTCTAGTATAGTGG - Intergenic
994921314 5:106047877-106047899 CTACTTCACTACAACCACAGTGG + Intergenic
995820026 5:116219314-116219336 CTACTGCACTACTACTAAAATGG - Intronic
998288328 5:140885759-140885781 CAAATTCACTAATACTATACAGG - Intronic
1003852568 6:10240351-10240373 CTAGTTTACTACTTTAATAGAGG - Intergenic
1010879099 6:81145809-81145831 CTAATTCACTATTATTATACTGG - Intergenic
1014678983 6:124404587-124404609 CTAGTTCACTATTACTGGAAGGG + Intronic
1014760539 6:125351947-125351969 CTAGTTCACTTACACCATAGGGG - Intergenic
1018964321 6:168472795-168472817 ATATTTTACTAATACTATAGGGG + Intronic
1029292272 7:99511161-99511183 CTAGCTCACTACTAACATATTGG - Intronic
1031280159 7:119789407-119789429 GTATTTCAATAATACTATAGTGG + Intergenic
1034290377 7:149926399-149926421 GTAGTTCACTGCTCCTAGAGTGG + Intergenic
1034660696 7:152766442-152766464 GTAGTTCACTGCTCCTAGAGTGG - Intronic
1038076862 8:24085585-24085607 GTAGTTCACTGCTACTATACTGG + Intergenic
1045406938 8:101875912-101875934 TCAGTTCACTACTACAACAGAGG - Intronic
1050303898 9:4286851-4286873 CTAGTTCACTTTTGCTACAGTGG + Intronic
1188323862 X:28775102-28775124 CAAGTTCACTTGTACTATAATGG - Intronic
1188377381 X:29448687-29448709 CAAGTTCTATACTACTATATAGG - Intronic
1199451611 X:147983424-147983446 CTATTTCACTCCTACTATAATGG - Intronic