ID: 1162244268

View in Genome Browser
Species Human (GRCh38)
Location 19:9386315-9386337
Sequence GTTTTAAAGGGGATCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162244259_1162244268 -2 Left 1162244259 19:9386294-9386316 CCCAAGAAGTTCCAGGCTGGAGT No data
Right 1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG No data
1162244260_1162244268 -3 Left 1162244260 19:9386295-9386317 CCAAGAAGTTCCAGGCTGGAGTT No data
Right 1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG No data
1162244258_1162244268 -1 Left 1162244258 19:9386293-9386315 CCCCAAGAAGTTCCAGGCTGGAG No data
Right 1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162244268 Original CRISPR GTTTTAAAGGGGATCAGGGA GGG Intergenic
No off target data available for this crispr