ID: 1162247523

View in Genome Browser
Species Human (GRCh38)
Location 19:9414690-9414712
Sequence CACTGACCTCCCCTCCGTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162247522_1162247523 -7 Left 1162247522 19:9414674-9414696 CCACATTGCTTAACATCACTGAC 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1162247523 19:9414690-9414712 CACTGACCTCCCCTCCGTTGTGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162247523 Original CRISPR CACTGACCTCCCCTCCGTTG TGG Exonic
900230619 1:1555175-1555197 CTCTGACCTCCCCTCTGATGTGG - Intronic
900615713 1:3564836-3564858 GACAGACCTCCCCTCCTGTGAGG + Intronic
902079544 1:13811814-13811836 CTCTGACCTCCCCACCTTAGTGG - Intronic
905291085 1:36922299-36922321 GCCTGACCTCCCCTACATTGTGG - Intronic
906961611 1:50422640-50422662 CACTGCCCTCCCCTCCCCTCCGG + Intronic
915531087 1:156502583-156502605 CACTGAACTCACCTCCTTTAAGG - Intergenic
1066425604 10:35304864-35304886 CTCTGATCTCCCCTGCCTTGAGG - Intronic
1068030519 10:51699300-51699322 CACTGAACTCCCGCCCATTGAGG + Exonic
1072241189 10:93496766-93496788 CACTGACCTGCCCTCCCTGGCGG - Exonic
1077439970 11:2563539-2563561 CACTGATTTCCCCTGGGTTGAGG + Intronic
1080951309 11:37036364-37036386 TACTGACCACTCCTCCTTTGTGG - Intergenic
1088315519 11:108502471-108502493 AACTGACATCCCCTCCCTTCAGG - Intergenic
1088684577 11:112274167-112274189 GACTGAGCTCCCCTGAGTTGGGG + Intergenic
1089632852 11:119794311-119794333 CCCAGCCCTCCCCGCCGTTGGGG + Intergenic
1090661619 11:128886323-128886345 CACTGAGATCCCCTCCTCTGTGG - Intergenic
1091168260 11:133499445-133499467 CCCTGGCCTCCCCTCCTGTGGGG + Intronic
1092904386 12:13088749-13088771 CCCTCCCCTCCCCTCCCTTGGGG - Intronic
1096109848 12:49022036-49022058 CTCTCACCTCCTCTCCTTTGGGG + Exonic
1096673095 12:53211646-53211668 CCCTGACCTCCCCGCTGTGGGGG - Exonic
1109155151 13:58900631-58900653 TAATGACCTCCCCTCAGTTAAGG - Intergenic
1111972749 13:94934097-94934119 CACTGAACTCCCATCCTCTGAGG + Intergenic
1112415380 13:99200206-99200228 CCCTGCCCTCCCCGCCGTGGTGG - Intergenic
1113708484 13:112448957-112448979 CACTGGCCTCCCCTTTGTTCAGG + Intergenic
1114538319 14:23436835-23436857 CCCTTTCCTCCCCTCCTTTGTGG - Intergenic
1116603463 14:46958568-46958590 CACTGACCTCACCTTAGTTCAGG - Intronic
1119170754 14:72534737-72534759 CACAGACCTCCCATCAGCTGGGG - Intronic
1120172481 14:81259552-81259574 GACAGACCACCCCTCAGTTGAGG + Intergenic
1120423116 14:84313669-84313691 CACTGTCTTCCCTACCGTTGAGG + Intergenic
1123017652 14:105383062-105383084 GCCTGGCCTCCCCTCAGTTGTGG + Intronic
1124625919 15:31307451-31307473 CAGTGGCCTCCCCTTCCTTGTGG + Intergenic
1127395747 15:58542675-58542697 CACTGATCTCCACTCCATAGGGG + Intronic
1133972297 16:10577071-10577093 CACTGAACTCCCCTCAGCTGTGG + Intronic
1138458277 16:57133427-57133449 CAGTGCCCTCCCCTCCCCTGGGG - Intronic
1142296521 16:89226702-89226724 CACAGAGCTGCCCTCCATTGTGG - Exonic
1146548852 17:33762877-33762899 CCCTGACTTCCAGTCCGTTGCGG + Intronic
1147387462 17:40090756-40090778 CACCGACCACCCCTCCCCTGGGG - Intronic
1151348856 17:73519729-73519751 CTCTGACCTCCCCTCTGTCCAGG + Intronic
1153924858 18:9826854-9826876 CTCTGACCTTCCCTCCTTCGCGG - Intronic
1158530416 18:58255784-58255806 CGCCGTCCTCCCCTCCGTTCTGG - Intronic
1159168153 18:64727891-64727913 CACTGACATCAACTCCATTGGGG + Intergenic
1161108301 19:2455392-2455414 CACTCACACCCCCTCAGTTGGGG + Intronic
1162247523 19:9414690-9414712 CACTGACCTCCCCTCCGTTGTGG + Exonic
1162265155 19:9567079-9567101 CACAGAGTTCCCCTCCATTGTGG + Exonic
1163664495 19:18596903-18596925 CACTGTCCTCCACTCGGTAGCGG + Exonic
1166392411 19:42416510-42416532 CACTGACCTCCCCTCCAGCTAGG - Intronic
933782596 2:85812562-85812584 CACTGGCCACCCCTCCGGTGGGG + Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
944565603 2:200987354-200987376 CTCTGTCCTACCCTCTGTTGTGG + Intronic
945150314 2:206783884-206783906 CACAGACCTCCCTCCTGTTGTGG - Intronic
948518862 2:238523173-238523195 CACTGTGCTCCAATCCGTTGGGG + Intergenic
1169252593 20:4071943-4071965 CACTGAGCTGTCCCCCGTTGGGG + Intronic
1175248520 20:57595559-57595581 CACTGACGTCCCCTGCTCTGGGG + Intergenic
1176178918 20:63740602-63740624 CCCTGACCTGGCCTCCGTCGGGG - Intronic
1178850008 21:36205223-36205245 CACTCACCTGCTCTCAGTTGTGG + Intronic
1178957109 21:37032459-37032481 CCCTGACCTCCCTTCCTCTGGGG + Intergenic
1179552359 21:42151243-42151265 CATTGACCTCCCCTCCTTGCTGG + Intergenic
1180975119 22:19843985-19844007 CACTGACCTCACCTCACCTGGGG + Intronic
953354813 3:42246672-42246694 CTCTGGCATCCCCTCCTTTGAGG + Intergenic
953475777 3:43204796-43204818 CACTGAACTCCCTTGCATTGTGG + Intergenic
954137364 3:48588201-48588223 CACTGTCCTCGCCTACCTTGCGG + Intronic
954590200 3:51776445-51776467 CACTCACCTCCTCTTCCTTGGGG + Intergenic
954961049 3:54565218-54565240 CACTGATGCCCCCTCCTTTGGGG - Intronic
963240421 3:142997517-142997539 CACTGACCACACCTCCGTGAAGG + Intronic
964554566 3:157922117-157922139 CACTGACCTCCATTCCAATGTGG + Intergenic
968985210 4:3871301-3871323 CAGTGACCTCCCTGCGGTTGAGG - Intergenic
970852601 4:20618937-20618959 CACTGACGGCTCCTCCTTTGTGG + Exonic
990736247 5:58866287-58866309 CAATTCCCTCCCCTTCGTTGTGG + Intergenic
1001301204 5:170535108-170535130 CCCTGACCTCTCCTAGGTTGCGG - Intronic
1001443438 5:171763774-171763796 TGCTGACCTCCCCTTCGGTGTGG + Intergenic
1002021898 5:176368790-176368812 CCCTGGCCTCTCCTCAGTTGGGG + Exonic
1002073608 5:176695326-176695348 CTCTGCCCTCCCCTCCCTTCTGG - Intergenic
1007926059 6:45650674-45650696 CAGTGGCCTCCCCTCCCTTCTGG - Intronic
1015441838 6:133257345-133257367 CACAGGCCTCACCTACGTTGGGG - Intronic
1017031343 6:150225528-150225550 CAGTGACCTCACTTCCCTTGTGG + Intronic
1017936450 6:159009865-159009887 AACTTACCTCCCCTACCTTGTGG + Intergenic
1021091830 7:16492668-16492690 CACTGAACTCCCATACATTGTGG - Intronic
1028505796 7:91568878-91568900 AACTGTCCTCCACTCCGCTGTGG + Intergenic
1038156176 8:24992502-24992524 TGCTGACCTCCCCCCAGTTGTGG - Intergenic
1038935498 8:32245448-32245470 AAATGACTTCCCCTCCTTTGTGG - Intronic
1038941703 8:32312559-32312581 CACAAACCTCACCTCCCTTGTGG - Intronic
1045063928 8:98428915-98428937 CACTGGCCTCCGCTCCCTGGGGG + Exonic
1048323892 8:133424150-133424172 CACTGACCTCACCTCCGCACAGG + Intergenic
1061144503 9:128789498-128789520 CACTGACTGCCTCTCCTTTGGGG - Intronic
1062708835 9:137960495-137960517 GGCTGACCTCCCCTCCCTGGCGG - Intronic
1191000630 X:55657275-55657297 AACTGAACTCTCCTCCGTGGAGG + Intergenic
1195659124 X:107361023-107361045 CACTGACATGCCCTCCCCTGGGG - Intergenic