ID: 1162248448

View in Genome Browser
Species Human (GRCh38)
Location 19:9422727-9422749
Sequence CGCTAAAGGCTGACCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162248441_1162248448 12 Left 1162248441 19:9422692-9422714 CCCGCTAAAAGTGCAGAGCAGAA 0: 1
1: 0
2: 2
3: 16
4: 159
Right 1162248448 19:9422727-9422749 CGCTAAAGGCTGACCCTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 70
1162248442_1162248448 11 Left 1162248442 19:9422693-9422715 CCGCTAAAAGTGCAGAGCAGAAG No data
Right 1162248448 19:9422727-9422749 CGCTAAAGGCTGACCCTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162248448 Original CRISPR CGCTAAAGGCTGACCCTGAA GGG Intronic
902156217 1:14488674-14488696 CACAAAATGCTGTCCCTGAAAGG + Intergenic
902808697 1:18876190-18876212 CCCTAAAGGGAGACCCTAAAAGG - Intronic
903815962 1:26064751-26064773 CTCTAAAGGCTTACCCAGCATGG + Intronic
913231279 1:116742529-116742551 CACTACACGCTGACCCTAAAGGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
918035396 1:180866550-180866572 AGCTTAAGACTGACTCTGAAAGG + Intronic
1062827177 10:581074-581096 CTAGAAAAGCTGACCCTGAAGGG - Intronic
1065206263 10:23360501-23360523 AGCAAATGGCTGAGCCTGAATGG - Intergenic
1074141255 10:110675048-110675070 CTCTAAATGCTGACTCTAAATGG + Intronic
1081993856 11:47351491-47351513 TGCTAAAAGCTGAGACTGAAGGG + Exonic
1088243531 11:107794424-107794446 GGCTAAAGACTGACCAAGAATGG + Intronic
1089964832 11:122647343-122647365 CCTTAAAGGCAGTCCCTGAAGGG - Intergenic
1097779291 12:63685069-63685091 TTGTAAAGGCTGACCCTGTAAGG + Intergenic
1098063852 12:66591340-66591362 TTCTTAAGGCTGACACTGAATGG + Intronic
1099422063 12:82473546-82473568 CCCTACAGGCTGCCCCTGGAGGG - Intronic
1101568759 12:105934193-105934215 CTCTAAAGGCTGACCCCATATGG + Intergenic
1102885470 12:116518527-116518549 CACGCAAGGTTGACCCTGAATGG - Intergenic
1103861584 12:124019020-124019042 CCCAAAAGGCTGACAGTGAAGGG + Intronic
1104985368 12:132593622-132593644 GGCTGCGGGCTGACCCTGAAGGG - Intergenic
1105052393 12:133066334-133066356 CAGCAAAGGCTGACCATGAAGGG + Intergenic
1114852496 14:26397723-26397745 TGCTAATGGCTGAATCTGAAGGG - Intergenic
1117409535 14:55438683-55438705 CACTACAGGCAGACCCTGCAGGG - Intronic
1119778951 14:77265672-77265694 CGCTGCAGGCTGAGCCAGAAAGG + Exonic
1124943133 15:34236652-34236674 CTCTAAAGTCTGTCACTGAAAGG - Intronic
1130294856 15:82639159-82639181 AGCTGAAGGCGGACCATGAAGGG - Intronic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1137244237 16:46689537-46689559 CGCAAAAGGAAGACCCTGATTGG + Intergenic
1142673095 17:1496520-1496542 AGCTAAAGGCTGGCAGTGAAGGG - Intronic
1145296052 17:21593363-21593385 CCCCAGAAGCTGACCCTGAAGGG + Intergenic
1145367742 17:22278698-22278720 CCCCAGAAGCTGACCCTGAAGGG - Intergenic
1154261784 18:12841289-12841311 CATTAAGGGCGGACCCTGAAGGG + Intronic
1158177432 18:54673184-54673206 CGCTAAAGACTGACTCTTAATGG - Intergenic
1158560147 18:58506613-58506635 CCCCAACGGCTGACCCTGGAAGG - Intronic
1162248448 19:9422727-9422749 CGCTAAAGGCTGACCCTGAAGGG + Intronic
1162400323 19:10442166-10442188 CTCTATAGGCTGACCTAGAAAGG - Intronic
1163381754 19:16973721-16973743 CCCTAAGGTGTGACCCTGAAGGG + Intronic
1166960806 19:46494936-46494958 CGCAACAGGTTGACCCAGAAGGG - Exonic
928610645 2:32988693-32988715 TGGGAAAGGCTGATCCTGAAGGG - Intronic
930237979 2:48905979-48906001 GCCCAAAGGCTGACCCAGAAAGG + Intergenic
933591680 2:84239942-84239964 CACTAAAGGCACAGCCTGAAAGG + Intergenic
933596519 2:84288643-84288665 AGCTACAGCCTGACCCTGCAGGG - Intergenic
941160339 2:162027999-162028021 GGCTCAAGGCTGCCACTGAAGGG - Intronic
1169353307 20:4887594-4887616 CACCAAATGCTCACCCTGAAAGG - Intronic
1173923029 20:46760157-46760179 CGATAAAGGAATACCCTGAAAGG - Intergenic
1174549266 20:51349887-51349909 TCCTAAAGGCTGCCCCAGAAAGG - Intergenic
1181129987 22:20725556-20725578 CACAAAAGGATGACCCTGTAAGG + Intronic
953796357 3:45989149-45989171 AGCTAAGGGCTGACCCAGAGAGG + Intronic
961671312 3:128533521-128533543 CTCTCAAGGCTGATTCTGAAAGG - Intergenic
961694004 3:128691432-128691454 CCCTACAGGCTGACCCAAAATGG + Intergenic
961732966 3:128980899-128980921 CCCTCATGGCTGACTCTGAAGGG - Intronic
968557159 4:1251404-1251426 AGCCAAACGCTGACCCTGGAGGG - Intergenic
972240697 4:37188696-37188718 CCCTCAGGGGTGACCCTGAAAGG + Intergenic
977149535 4:93492671-93492693 TGCCAAAGTCTTACCCTGAATGG - Intronic
987479518 5:18435469-18435491 CGCTATCAGCTCACCCTGAACGG - Intergenic
1001466453 5:171971052-171971074 CGCTAAATGCTGGAGCTGAAAGG + Intronic
1007286709 6:40753089-40753111 GGCTGAAGGCTCACCCAGAAAGG + Intergenic
1008112421 6:47507265-47507287 CACTAAAGGATGACTTTGAAGGG - Intronic
1020561180 7:9729642-9729664 CCCTAAGGTGTGACCCTGAAGGG - Intergenic
1022938215 7:35202756-35202778 TTGTAAAGGCTGACCCTGTAAGG + Exonic
1023936536 7:44744015-44744037 AGGGAAAGGGTGACCCTGAAGGG - Intergenic
1024576434 7:50768196-50768218 CGATAAAGGCAAACCCTGAGTGG + Intronic
1034917971 7:155056532-155056554 CCCTAAAGTCTATCCCTGAAGGG - Intergenic
1035572679 8:683409-683431 CCCTCACGGCTGACCCTGGAGGG - Intronic
1046821100 8:118635363-118635385 CGCTGAGAGCTGACCTTGAAAGG + Intergenic
1048932558 8:139326536-139326558 TGCTAATGGCTGACCGTGGAGGG + Intergenic
1050489615 9:6173886-6173908 TGCCAGAGGCTGACCCTAAAGGG + Intergenic
1051758410 9:20432885-20432907 GACTAATGGCTGACCCTAAAAGG + Intronic
1052250716 9:26394171-26394193 AGCCAGTGGCTGACCCTGAAGGG - Intergenic
1052399921 9:27987380-27987402 CTCAAAAGGCTGAGCCTGGAGGG - Intronic
1055274569 9:74599808-74599830 TGCTAATGGCTGCCCCAGAATGG + Intronic
1061820673 9:133225782-133225804 CGCTCAAGGATGACACTGCAGGG + Intergenic
1062238601 9:135524285-135524307 CGCTCAAGGATGACACTGCAGGG - Intronic
1187449345 X:19382947-19382969 CGCTAAAGAGAGACCCTGGAAGG + Intronic