ID: 1162248778

View in Genome Browser
Species Human (GRCh38)
Location 19:9425322-9425344
Sequence TACTCACAGATCCCCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162248778 Original CRISPR TACTCACAGATCCCCAGGAT GGG (reversed) Intronic
902268636 1:15287382-15287404 GACTCACAGTTCCCCAGGGCTGG + Intronic
903061049 1:20669047-20669069 TATTTACAGATCCTCAGGCTAGG - Intronic
905659670 1:39711871-39711893 TACTCACAGTTCCCTAGAAATGG + Intronic
905921981 1:41725707-41725729 CACTATCAGATCTCCAGGATAGG + Intronic
913674858 1:121131054-121131076 TATTCACAGAGTCCAAGGATTGG + Intergenic
914026697 1:143918686-143918708 TATTCACAGAGTCCAAGGATTGG + Intergenic
914348541 1:146820296-146820318 TACTCACAGATTCCAGGAATTGG + Intergenic
914665079 1:149826121-149826143 TATTCACAGATTCCAAGGATTGG + Intergenic
914670686 1:149867700-149867722 TATTCACAGATTCCAAGGATTGG - Intronic
915569558 1:156737088-156737110 TACTCACAGATTTCCATGAAGGG + Intergenic
916042306 1:160971661-160971683 TACTCACAGTTCCCAAGGGAAGG + Intergenic
917796655 1:178537826-178537848 TGCTCACAGTGCCCCAGCATTGG + Intronic
918334200 1:183491785-183491807 TTCTCACAGATCCAGAGGCTGGG + Intronic
920068770 1:203287774-203287796 TACTCAGCGATCCCAAGGCTGGG - Intergenic
920325134 1:205157067-205157089 GACTCACAGTTCCACAGGGTTGG - Intronic
921309988 1:213833138-213833160 GATTCACAGAACCCCAGAATGGG + Intergenic
923226537 1:231943247-231943269 TACTCACAGTTCCCAAGGGCTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923898833 1:238303640-238303662 GACTCACAGTTCCACAAGATGGG + Intergenic
1063506865 10:6607495-6607517 GACTCTCAGGTCCCCAGGGTGGG - Intergenic
1064564008 10:16621578-16621600 AACTCACAGTTCCACATGATTGG + Intronic
1065468749 10:26054536-26054558 TATTCACAGATCCCAGGGATTGG - Intronic
1069083812 10:64116382-64116404 TATTGCCAGATCCCCAGAATAGG - Intergenic
1070952618 10:80443459-80443481 AACTCTGAGGTCCCCAGGATGGG - Intergenic
1071551088 10:86566732-86566754 TACTCAGAAATCCCCAGGCCTGG - Intergenic
1071559383 10:86633163-86633185 TACTCAGAGATCCCCAGGCCTGG + Intergenic
1073150940 10:101311063-101311085 GACTCAGAGATCACCAGGAGGGG - Intergenic
1075450932 10:122551569-122551591 AACTCACCGTGCCCCAGGATTGG - Intergenic
1077667886 11:4131096-4131118 GACTCACAGTTCCGCAGGGTTGG + Intronic
1079735615 11:23993892-23993914 CTCTCACATACCCCCAGGATAGG + Intergenic
1079882547 11:25944797-25944819 GCCTCACACACCCCCAGGATAGG - Intergenic
1080205480 11:29724447-29724469 GACTCACAGTTCCACATGATTGG + Intergenic
1080641563 11:34161391-34161413 TACTTCCAAATCCCCAGGCTGGG - Intronic
1081121876 11:39276698-39276720 TATTCACAGATTCCTAGGGTAGG + Intergenic
1082621195 11:55424284-55424306 GACTCACAGTTCCGCATGATTGG - Intergenic
1084235043 11:67782300-67782322 GACTCACAGATCCACATGACTGG - Intergenic
1084436440 11:69144294-69144316 TACTCACAGATCTGCAGGGGAGG + Intergenic
1084775430 11:71371794-71371816 TACTCTCAGATCCCATGGAGGGG + Intergenic
1085121416 11:73969862-73969884 TACTCACATAACCCCAGGAAGGG - Intronic
1086032731 11:82379785-82379807 GACTCACAGATCCACATGACTGG + Intergenic
1089136031 11:116250050-116250072 TCCTCATGGGTCCCCAGGATGGG + Intergenic
1090098700 11:123771244-123771266 TACTCACAGTTCCACATGACTGG + Intergenic
1091369874 11:135049002-135049024 GACTCACAGTTCCCCATGACTGG + Intergenic
1093014903 12:14145856-14145878 GACTCACAGTTCCACAGGACGGG + Intergenic
1093391704 12:18631891-18631913 TATTCACAGATCTCTAGGCTGGG + Intronic
1093426440 12:19033767-19033789 GACTCACAGTTCCCCATGGTTGG - Intergenic
1093731539 12:22571075-22571097 TATTCACAGATTCCCTGAATGGG - Intergenic
1094814430 12:34169231-34169253 GACTCACAGTTCCACATGATTGG - Intergenic
1095102494 12:38199353-38199375 GACTCACAGTTCCACATGATTGG + Intergenic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1096471723 12:51882118-51882140 GACTCACAGTTCCGCAGGGTTGG + Intergenic
1098972204 12:76868533-76868555 GACTCACAGTTCCACATGATTGG - Intronic
1099566020 12:84247070-84247092 TACTCACAGATCCACATGGCTGG - Intergenic
1099819557 12:87693114-87693136 GACTCACAGTTCCACAGGGTTGG + Intergenic
1100675015 12:96856949-96856971 TACTCACAGTTCTGCAGGACTGG + Intronic
1101241877 12:102847113-102847135 GAATCACAGATCTCCAGGGTAGG + Intronic
1101923441 12:108951891-108951913 GCCACACAGATCCCCAGGAGGGG - Intronic
1102819431 12:115895401-115895423 TACTCACAGATCCCCAGTGTGGG + Intergenic
1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG + Intergenic
1105861208 13:24415701-24415723 TACTTTCAGAGGCCCAGGATGGG + Intergenic
1106549872 13:30761889-30761911 TACTCTCAGTTCCTCAGAATGGG - Intronic
1106911024 13:34463797-34463819 CCCTCACAGATGCTCAGGATGGG + Intergenic
1107003401 13:35578305-35578327 TCCTCACAGATCCACAGAAATGG - Intronic
1108863963 13:54899231-54899253 TACTCACAGTTCCAGAGGCTGGG - Intergenic
1110124999 13:71931678-71931700 GACTCACAGTTCCCCAGGGCTGG - Intergenic
1110461853 13:75753765-75753787 GACTCACAGTTCCACAGGACTGG - Intronic
1111421793 13:88019968-88019990 GACTCACAGTTCCACAGGGTTGG - Intergenic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1112438769 13:99410018-99410040 TACTCACAGATCCCAAGAGGAGG - Intergenic
1112562604 13:100527396-100527418 GACTCAGAGATCCCCAGGGTAGG + Intronic
1112700758 13:102004931-102004953 AACTCACAGTTCCACAGGACTGG - Intronic
1115249222 14:31328916-31328938 GACTCACAGTTCCACATGATTGG + Intronic
1116440572 14:44947035-44947057 TATTCACAGATTCCAGGGATAGG - Intronic
1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG + Intronic
1125439108 15:39682493-39682515 TTCTCACTGCTCCCCAGGAAGGG + Intronic
1126258207 15:46653405-46653427 TACTCTCAGATCCTCATGCTAGG + Intergenic
1126513582 15:49508918-49508940 TACTCACAGTTCCCAAGAGTAGG + Intronic
1131946577 15:97628934-97628956 TACTCACAGTTCCACAGGGCTGG + Intergenic
1133087307 16:3374937-3374959 TACTTACAGATCCTCAAGATAGG + Intronic
1134636587 16:15796636-15796658 TATTCACAGATTCTGAGGATAGG - Intronic
1135149336 16:19991906-19991928 CACTCACAGCTGCCCAGGAGAGG - Intergenic
1135191081 16:20355182-20355204 TACTCACAGATCCCAAGAGAAGG - Intronic
1137987722 16:53124316-53124338 GACTCACAGTTCCACAGGGTTGG + Intronic
1138512547 16:57516907-57516929 AACTCACAGAGCTCCAGGGTGGG - Intronic
1138806412 16:60094661-60094683 GACTCACAGTTCCCCAGGTCTGG - Intergenic
1138968008 16:62109696-62109718 GACTCACAGTTCCACATGATTGG - Intergenic
1139270065 16:65673511-65673533 AACTCACAGATGACCAGGAGGGG - Intergenic
1139667053 16:68464650-68464672 TATTCACAGATGTCCAGGAGTGG + Intergenic
1139797566 16:69495894-69495916 TCCTCCCAGGTCCCCAGCATTGG + Intergenic
1139985495 16:70895252-70895274 TACTCACAGATTCCAGGAATTGG - Intronic
1142115804 16:88355533-88355555 TCCTCACCCACCCCCAGGATCGG - Intergenic
1142537767 17:631680-631702 TACACACCGATCCACAGGGTCGG + Intronic
1147127752 17:38383951-38383973 TGGTCACAAATCCCCAGGAAAGG - Intronic
1147594550 17:41708441-41708463 TATTCACAGGTTCCAAGGATTGG + Intergenic
1149076652 17:52603643-52603665 GACTCACAGTTCCACAGGCTGGG + Intergenic
1150590337 17:66556810-66556832 GACTCACAGATCCACAGGCCTGG - Intronic
1151245562 17:72791887-72791909 GACTCACAGATCTGCAGGGTTGG - Intronic
1151700601 17:75740680-75740702 TACCCAGAGATCCTCAGGGTTGG - Intronic
1153698085 18:7664282-7664304 TAATCCCACATCCCCAGGACAGG - Intronic
1155046750 18:22109631-22109653 TACTCCCATCTCCCCAGGGTGGG - Intergenic
1155788269 18:29930030-29930052 TACTCACAGTTCTGCAGGTTGGG - Intergenic
1155984223 18:32212855-32212877 TACTCACCGATCTCTAGGAAAGG + Intronic
1156910903 18:42409931-42409953 GACTCACAGTTCCACAGGCTAGG + Intergenic
1158638167 18:59179508-59179530 TACTCACAGTTCTAGAGGATAGG + Intergenic
1160469125 18:79111602-79111624 TACTCACAGATCTCAGAGATTGG + Intronic
1161140108 19:2642167-2642189 TTCTCACAGACCCCCACCATGGG + Intronic
1161155625 19:2730862-2730884 TACTTACAGACCCCCTGGAGTGG + Intronic
1161155679 19:2731053-2731075 TACTTACAGACCCCCTGGAGTGG + Intronic
1162248778 19:9425322-9425344 TACTCACAGATCCCCAGGATGGG - Intronic
1162834417 19:13306935-13306957 TACTCACAGATCCTCAGAGAAGG - Intronic
1165162130 19:33822827-33822849 TACTCACAGATCCCAGGTTTAGG + Intergenic
1165401848 19:35606051-35606073 GACTCACAGTTCCGCAGGGTTGG + Intergenic
1166358261 19:42240196-42240218 TCCTCCCACAGCCCCAGGATAGG - Intronic
1166888493 19:45975400-45975422 TGCTCTCAGGTCCCCAGGATGGG + Intergenic
924993347 2:335366-335388 CACTCACAGATGCTCAGGAAGGG + Intergenic
925556561 2:5137189-5137211 TGTTCACAGGTCCCCAGGGTTGG - Intergenic
925692633 2:6540359-6540381 GACTCACAGTTCCGCAGGACTGG - Intergenic
926698999 2:15790284-15790306 CACTCACACATCAGCAGGATTGG + Intergenic
933627044 2:84612831-84612853 TACTAACATATCCACAGGTTTGG + Intronic
935358148 2:102223901-102223923 TTCTCACAAGTGCCCAGGATTGG + Intronic
935918940 2:107988368-107988390 CACTCACAGATGCCAAGGAAGGG - Intronic
936886622 2:117318494-117318516 CAGTCACAGATTCCAAGGATTGG + Intergenic
937887528 2:126910026-126910048 TACTCACAGATCCCAAGAGAAGG - Intergenic
939395017 2:141617678-141617700 TACTGACAGATTCACAAGATAGG + Intronic
939453996 2:142409821-142409843 TACTCACAGTTCCCAAGAAGAGG + Intergenic
939824509 2:146998766-146998788 GCCTCACAGATCCCAAGGAATGG - Intergenic
940178737 2:150907807-150907829 AACTCCCGGTTCCCCAGGATTGG - Intergenic
942113512 2:172705421-172705443 CACTCAAAGATTCCCAGGGTTGG - Intergenic
942226923 2:173824476-173824498 TTCTCACAGATCCAGAGGTTAGG - Intergenic
944218961 2:197283117-197283139 TTCTCACTGACCCACAGGATAGG + Intronic
944472702 2:200072100-200072122 GACTCACAGTTCCACAGGACTGG + Intergenic
945145756 2:206736370-206736392 GACTCACAGTTCCACAGGGTGGG + Intergenic
945250860 2:207765834-207765856 TAATCACAGCTCTCCAGGAGAGG + Exonic
1168748776 20:267369-267391 GACTCACTGAGCCCCAGAATAGG + Intergenic
1168794796 20:604416-604438 TCCTCACAGCTCTCCAGGATCGG + Exonic
1170830208 20:19833159-19833181 TACTCACAGATCCCAAGAGGAGG - Intergenic
1172252138 20:33487366-33487388 TACTCAGAGAGTCCCAGGAAGGG - Intergenic
1174188937 20:48726306-48726328 TACTTGCAGATCCTCTGGATCGG + Exonic
1176343864 21:5723274-5723296 GACTCACAGTTCCACAAGATTGG + Intergenic
1176500963 21:7601182-7601204 GACTCACAGTTCCACAAGATTGG - Intergenic
1176538185 21:8121343-8121365 GACTCACAGTTCCACAAGATTGG + Intergenic
1176658023 21:9605391-9605413 GACTCACAGTTCCACAGGACTGG - Intergenic
1178883442 21:36466360-36466382 GACTCACAGTTCCGCAGGACTGG + Intronic
1179140045 21:38717375-38717397 TAGTCACAGATTCCGGGGATTGG - Intergenic
1179264571 21:39791809-39791831 TACTCACACATTCCCATTATGGG - Intronic
1181443799 22:22953028-22953050 TACTCACAGATCTCAAGAAAAGG + Intergenic
1184324978 22:43775976-43775998 TGCTCACAGATCCACAGTTTGGG - Intronic
1203243132 22_KI270733v1_random:37699-37721 GACTCACAGTTCCACAAGATTGG + Intergenic
951780245 3:26355022-26355044 TACTCACAGATCCACATGGCTGG + Intergenic
952585323 3:34885841-34885863 TTCTCACAGTTCCGAAGGATGGG - Intergenic
952677951 3:36055526-36055548 GACTCACAGTTCCACAGGCTTGG - Intergenic
953914064 3:46906706-46906728 CACTCTCAGATCCCCAGGATGGG - Intergenic
956962367 3:74417935-74417957 TTCTAACCTATCCCCAGGATAGG + Intronic
956978813 3:74613876-74613898 TACTCACAGATCAGCAGCTTGGG - Intergenic
957142904 3:76384608-76384630 GACTCACAGTTCCACAGGACTGG + Intronic
958729412 3:97945650-97945672 TACTCACAGAGCTCCTGCATGGG - Intronic
959200886 3:103245319-103245341 TACTCACAGGTACCCAAGAGTGG + Intergenic
959502236 3:107119505-107119527 AACTCAGAGACCTCCAGGATTGG + Intergenic
960042520 3:113165080-113165102 TACACACAGAAACACAGGATTGG + Intergenic
960320904 3:116234215-116234237 TGATCACAGATCCCATGGATTGG + Intronic
961847503 3:129778848-129778870 GACTCACAGATCCACAGGGCTGG - Intronic
962718865 3:138153675-138153697 GACTCACAGTTCCCCAAGACTGG + Intergenic
963531314 3:146476346-146476368 AAAGCACAGATCCCCAGGCTGGG - Intronic
964972804 3:162581966-162581988 GACTCACAGATCCACAGGACTGG - Intergenic
969897506 4:10319214-10319236 TATTCACAGGTTCCAAGGATGGG + Intergenic
970261236 4:14227090-14227112 TACTCATAGATCCCAAGAAGCGG - Intergenic
972908758 4:43786390-43786412 TATTCACAGATTCCAAAGATTGG - Intergenic
973747180 4:53975240-53975262 GACTCACAGTTCCCCAGGGCTGG - Intronic
974013617 4:56629400-56629422 AACTCACAGTTCCACAGGGTTGG + Intergenic
974567720 4:63599575-63599597 TACTCACAGTTTTCCAGGGTTGG + Intergenic
974925431 4:68292250-68292272 GACTCACAGATCCACATGGTTGG + Intergenic
975959050 4:79878375-79878397 GACTCACAGTTCCCCATGGTTGG - Intergenic
976042570 4:80905608-80905630 GACTCACAGTTCCACAGGGTTGG + Intronic
977122144 4:93115651-93115673 GACTCACAGTTCCACAGGACTGG + Intronic
977129600 4:93218774-93218796 TACTCACAGTTCCTCAGGGCAGG + Intronic
977670878 4:99693396-99693418 TACTCACACATCCCCAGAGGAGG - Intergenic
978630126 4:110734489-110734511 TATTCACAGGTTTCCAGGATTGG + Intergenic
978735228 4:112077160-112077182 TCCTCCCACTTCCCCAGGATGGG - Intergenic
978817603 4:112926919-112926941 GACTCACAGTTCCACAGGACTGG + Intronic
979174252 4:117642825-117642847 TACTCACAGTTCCCCATGGCTGG + Intergenic
979288170 4:118950344-118950366 TACTCACAGTTCCCAAGGGTAGG + Intronic
979378858 4:119984503-119984525 TACTCATAGATCCCTAGAAACGG + Intergenic
980942329 4:139286499-139286521 GACTCACAGACCCCAAGAATAGG - Intronic
981759014 4:148173247-148173269 CATTCACAGATCCCAGGGATTGG - Intronic
981961509 4:150545465-150545487 TAATAACAGATTCCCTGGATGGG - Intronic
983139723 4:164135413-164135435 AACTCACAGTTCCACAGGGTTGG + Intronic
983305336 4:165977426-165977448 GACTCACTGATCCACACGATTGG - Intronic
984218536 4:176944626-176944648 TAGTCACAGGTTCCCAGGATTGG + Intergenic
984331719 4:178329445-178329467 TACTCACAGATACGCAGCAAGGG + Intergenic
985417388 4:189750682-189750704 GACTCACAGTTCCACAGGACTGG + Intergenic
985991103 5:3562032-3562054 GACTCACAGTTCCCCATGGTTGG - Intergenic
986054536 5:4122836-4122858 GACTCAGGGATCCCCAGGAATGG - Intergenic
986106743 5:4667062-4667084 AACTCACAGTTCCACAGGCTGGG + Intergenic
986128918 5:4909425-4909447 GACTCACAGTTCCGCAGGACGGG + Intergenic
986138588 5:5006897-5006919 GACTCACAGTTCCACAGGCTGGG - Intergenic
986171061 5:5315053-5315075 GACTCACAGTTCCGCAGGACTGG + Intronic
988396199 5:30700151-30700173 AACTCACAGTTCCACAGGAGGGG - Intergenic
989347525 5:40446631-40446653 GACTCACAGTTCCCCATGACTGG + Intergenic
989460362 5:41690638-41690660 TACTCACAGATCCACAGGGCTGG - Intergenic
993711678 5:91231277-91231299 GACTCACAGTTCCACAGGACTGG + Intergenic
993811368 5:92481583-92481605 TACTCACAGTTCCGCAGAGTTGG - Intergenic
994929247 5:106159856-106159878 TACTCACAGATTATCAGCATTGG + Intergenic
995392962 5:111659875-111659897 GACTCACAGTTCCACAGGCTGGG + Intergenic
996611343 5:125383545-125383567 TTCTCACAGATCCGGAGGGTGGG - Intergenic
999832425 5:155333249-155333271 TACTCACAGCTCCTGGGGATAGG - Intergenic
1001978512 5:176021110-176021132 TACTCACAGATCCCAGAGAGAGG + Intronic
1002238905 5:177822652-177822674 TACTCACAGATCCCAGAGAGAGG - Intergenic
1003109373 6:3240758-3240780 TTCTCACAGCTCCCCAGTGTTGG - Intronic
1004181153 6:13381528-13381550 GACTCACTGATTCCCAGGAAAGG + Intronic
1004249879 6:14015130-14015152 TACCCACAGTTCTCAAGGATGGG + Intergenic
1007127903 6:39442715-39442737 TCCACTCAGATTCCCAGGATTGG - Intronic
1008966987 6:57322629-57322651 GACTCACAGTTCCCCAGGGCTGG - Intronic
1010836299 6:80591178-80591200 TACTCACAGTTCCACAGGGCTGG + Intergenic
1012350946 6:98249519-98249541 CACTCACAGACTCCCAGGCTAGG + Intergenic
1012422868 6:99084119-99084141 TACTCACAGACCACCAGAAGGGG + Intergenic
1012524711 6:100163590-100163612 TAATCACAGATAGCCAGGGTTGG + Intergenic
1016907784 6:149168918-149168940 TACTCACAGTTCCCAAGGGGAGG + Intergenic
1018744842 6:166754304-166754326 TACTCACAGATCCCAAGAGAGGG + Intronic
1019860170 7:3651069-3651091 TACACACACATGCCCAGGAGTGG + Intronic
1022032104 7:26501442-26501464 GACTCACAGTTCCGCAGGACTGG - Intergenic
1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG + Intergenic
1022810303 7:33861779-33861801 TACTCACAGATCCCAAGAGAAGG + Intergenic
1022810798 7:33866395-33866417 GACTCACAGTTCCGCATGATTGG - Intergenic
1023354073 7:39349824-39349846 CACTCACAGGGCCCCAGGACTGG - Intronic
1024600442 7:50975783-50975805 TATTCACAGATTCCCGGGTTAGG - Intergenic
1024670571 7:51590050-51590072 TTCTCACAGATCCCAAGAAGAGG - Intergenic
1026235290 7:68521649-68521671 TACTCACAGTTCCCCAGGGGAGG - Intergenic
1026564213 7:71476437-71476459 TACTCACAAATCCCCTGAACAGG + Intronic
1027725381 7:81799041-81799063 TTCTCACAGGGCCCCATGATGGG + Intergenic
1027782474 7:82536625-82536647 GACTCACAGATCCCCATGGCTGG - Intergenic
1027830356 7:83169248-83169270 TACTCACAGTTCCACAGGGGTGG - Intergenic
1030658920 7:112198349-112198371 TTCTCACAGTTCCGCAGGCTAGG - Intronic
1030745998 7:113167192-113167214 TACTCACAGATCCCAAGAGAAGG + Intergenic
1031614581 7:123865858-123865880 GACTCACAGATCCACATGGTTGG + Intronic
1031752125 7:125589162-125589184 GACTCACATTTCCCCAGGACTGG + Intergenic
1032746481 7:134791806-134791828 GACTCACAGTTCCACATGATTGG + Intronic
1034928707 7:155143784-155143806 TACTCACAGATCCCTAGAGGAGG + Intergenic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1036223190 8:6938219-6938241 TACTTACAGATCCTCAAGCTAGG + Exonic
1036225288 8:6952896-6952918 TACTTACAGATCCTCAAGCTAGG + Intergenic
1036229724 8:6989652-6989674 TACTTACAGATCCTCAAGGTAGG + Intergenic
1036232175 8:7008755-7008777 TACTTACAGATCCTCAAGGTAGG + Intronic
1036279321 8:7386132-7386154 GACTCACAGTTCCGCAGGGTTGG - Intergenic
1036342193 8:7925741-7925763 GACTCACAGTTCCGCAGGGTTGG + Intergenic
1036412393 8:8514196-8514218 GACTCACAGTTCCTCAGGACTGG - Intergenic
1037005519 8:13775032-13775054 TAATCACAGGTCCCCAATATTGG + Intergenic
1037341496 8:17850231-17850253 GACTCAGAGATCAGCAGGATTGG - Intergenic
1038222570 8:25624641-25624663 TACTCACAGTTCTGCAGGCTGGG - Intergenic
1038698997 8:29832271-29832293 TACTCACAGTTCCCAAGACTGGG + Intergenic
1038766585 8:30434264-30434286 AAATCACAGATCCCCAGTACTGG - Intronic
1038843507 8:31207527-31207549 TACTCACAGTTCCACATGGTTGG - Intergenic
1039273658 8:35910965-35910987 GACTCACAGTTCCACAGGCTGGG + Intergenic
1039781845 8:40793854-40793876 TACTAAGAGATCCCAAGGAGGGG - Intronic
1039883850 8:41644497-41644519 GACCCCCAGACCCCCAGGATGGG - Intergenic
1040689936 8:49924567-49924589 TACTCACAGATGATCAGGTTAGG + Intronic
1040697045 8:50012638-50012660 TACTCACAGTTCCCTAGAAGAGG + Intronic
1041654501 8:60335607-60335629 TACTCACATTTCCACAGGGTTGG - Intergenic
1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG + Intergenic
1042803570 8:72747082-72747104 TACTCACAGATCCCTAGAAATGG + Intronic
1044443761 8:92249925-92249947 TGCTCACAGATCTGCAGGTTGGG - Intergenic
1044450786 8:92334030-92334052 TACTCACAGATCCACATGGCTGG - Intergenic
1046310311 8:112427527-112427549 GACTCACAGTTCCTCAGGACTGG - Intronic
1047676694 8:127210312-127210334 TTCTCACAGATCACCAGGTAGGG + Intergenic
1050053763 9:1630728-1630750 TACTCACAGACCCAGAGCATAGG - Intergenic
1050426710 9:5519007-5519029 TACTCACAGATCCCAAGAGAAGG + Intronic
1050668458 9:7968245-7968267 TACTCACAGATCCCAAGAGGAGG - Intergenic
1051023224 9:12571042-12571064 GACTCACAGTTCCACAGGGTTGG + Intergenic
1055068056 9:72138604-72138626 TCCTCACAGAGCCCCATGATGGG + Intronic
1056089526 9:83191209-83191231 TTGTCACAGCTTCCCAGGATAGG - Intergenic
1056118399 9:83463357-83463379 GACTCACAGTTCCACAGGACTGG + Intronic
1058429820 9:104908276-104908298 TATTCACAAATACCTAGGATGGG - Intronic
1059675054 9:116529862-116529884 TACTCACAGTTCCCCATGGCTGG - Intronic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1060169526 9:121450044-121450066 TACTCACAAAACACCATGATTGG - Intergenic
1060554140 9:124499730-124499752 TACTGAGAGAGCCCCAGAATAGG + Intronic
1203459457 Un_GL000220v1:20781-20803 GACTCACAGTTCCACAAGATTGG + Intergenic
1203635752 Un_KI270750v1:108966-108988 GACTCACAGTTCCACAGGACTGG - Intergenic
1185650115 X:1641646-1641668 TACTCATGGACCACCAGGATGGG - Intronic
1185650131 X:1641729-1641751 TACTCATGGACCACCAGGATGGG - Intronic
1185951480 X:4440247-4440269 GACTCACAGTTCCACAGGGTTGG + Intergenic
1186290388 X:8091025-8091047 GACTCACAGTTCCACAGGCTGGG - Intergenic
1186831086 X:13390714-13390736 TACTCGCAGATCCCAAGAGTAGG - Intergenic
1187435785 X:19267853-19267875 TACTCACAGATCCCAAGAGGAGG + Intergenic
1187663048 X:21572523-21572545 GACTCACAGTTCCACAGGACTGG + Intronic
1188761778 X:34041356-34041378 GACTCACAGCTCCACAGGACTGG - Intergenic
1189161368 X:38812680-38812702 TACTCACACTGACCCAGGATGGG - Intergenic
1191900750 X:66038802-66038824 GGGTCACAGAGCCCCAGGATAGG + Intronic
1192113579 X:68389942-68389964 GACTCACAGTTCCACAGGGTTGG + Intronic
1192757528 X:74062133-74062155 TACTCACAGATCACAAGAAGAGG - Intergenic
1193084550 X:77437664-77437686 TAATCAAAGATCACCAGGCTAGG - Intergenic
1194253832 X:91612700-91612722 GACTCACAGTTCCACAGGACTGG + Intergenic
1194867325 X:99085474-99085496 TACTCACTGCTCCCCTGGGTAGG - Intergenic
1195613338 X:106893757-106893779 GACTCACAGTTCCCCAGGGATGG + Intronic
1196536039 X:116845604-116845626 TAATCACAGATCCCTAGGATAGG - Intergenic
1199206814 X:145159063-145159085 GACTCACAGTTCCACAGGGTGGG + Intergenic
1200040505 X:153362632-153362654 CACCCACAGATCCCCAGAAGTGG + Intergenic
1200345132 X:155440277-155440299 GACTCACAGTTCCACAGGCTTGG + Intergenic
1200572617 Y:4852277-4852299 GACTCACAGTTCCACAGGACTGG + Intergenic
1200803170 Y:7404959-7404981 GACTCACAGTTCCACAGGGTTGG - Intergenic
1201485123 Y:14485892-14485914 TGCTCAGAAATCCACAGGATTGG - Intergenic