ID: 1162248878

View in Genome Browser
Species Human (GRCh38)
Location 19:9425897-9425919
Sequence ACTGAGAGGCAGAAGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 541}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162248873_1162248878 3 Left 1162248873 19:9425871-9425893 CCTCACTCTGGCATAACGGGCTT 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG 0: 1
1: 0
2: 4
3: 48
4: 541
1162248867_1162248878 21 Left 1162248867 19:9425853-9425875 CCAACTGTATTCCCAAGGCCTCA 0: 1
1: 0
2: 5
3: 24
4: 225
Right 1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG 0: 1
1: 0
2: 4
3: 48
4: 541
1162248869_1162248878 10 Left 1162248869 19:9425864-9425886 CCCAAGGCCTCACTCTGGCATAA 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG 0: 1
1: 0
2: 4
3: 48
4: 541
1162248870_1162248878 9 Left 1162248870 19:9425865-9425887 CCAAGGCCTCACTCTGGCATAAC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG 0: 1
1: 0
2: 4
3: 48
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162248878 Original CRISPR ACTGAGAGGCAGAAGGGGTA AGG Intronic
900371948 1:2336148-2336170 GCAGAGAGGCAGGAGGGGTGCGG - Intronic
900483782 1:2911836-2911858 TCTGAGAGGAGGAAGGGGGAGGG + Intergenic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901839698 1:11946134-11946156 ACTGAGTCTCAGAAGGGCTAGGG + Intronic
902264243 1:15249912-15249934 ACTGAGATGCAGAGAGGTTAAGG - Intronic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902785088 1:18728004-18728026 ATTGAGAGGAAGAGGGGGTGAGG + Intronic
903234665 1:21942058-21942080 ACAGGGAGGCAGAATGGGTGTGG - Intergenic
903367847 1:22815933-22815955 TCTGAGAGGCAGAAGGTGTGTGG + Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904080571 1:27869879-27869901 ACTGAGACTCAGAGAGGGTATGG + Intergenic
904442301 1:30539694-30539716 ACTTAGAGGCTAAAGGGGGAGGG - Intergenic
905970735 1:42140418-42140440 ACTGAGAGCCAGCATGGTTAGGG + Intergenic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906646301 1:47477988-47478010 ACTGAGGGTCAGAAAGGGGAAGG - Intergenic
907114733 1:51958803-51958825 ACTGAGGGGCAGAACTGATAGGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908845795 1:68323137-68323159 ACTGAGGGGCAGAAAAGGGATGG - Intergenic
909092840 1:71248014-71248036 ATTGAGAGACAGGAGTGGTATGG + Intergenic
909591439 1:77353610-77353632 AGTGAGACGCAGAGTGGGTAAGG - Intronic
910015685 1:82520420-82520442 ACTGAGAGGCAGGATGGAAAAGG + Intergenic
910557279 1:88549345-88549367 ACTAAGAGAGACAAGGGGTATGG - Intergenic
910738484 1:90489187-90489209 ACTTGGAGGGAGGAGGGGTAGGG - Intergenic
911614478 1:99993446-99993468 ACCGAGAGGGAGAAGGGAGAGGG - Intronic
912560519 1:110548274-110548296 CCTGAGGGGCAGAAGTGGGAAGG - Intergenic
912564983 1:110580944-110580966 AATGAGAGGCAGCAGGGCTCTGG + Intergenic
914420350 1:147522942-147522964 TCTGAGAGGCTGAAGTGGGAGGG + Intergenic
915271434 1:154756452-154756474 ACTGAGCCGCAGAAGGGGGCAGG - Intronic
915528390 1:156489809-156489831 CCTGAGAGGCAGCAGAGGTGAGG + Intronic
915584308 1:156835928-156835950 ACGGAGAGGGAGAAGGGGCCTGG - Intronic
916813026 1:168322313-168322335 ACTGAGAGAAGGAAGTGGTAGGG - Intergenic
917532954 1:175853310-175853332 ACTGAATGGCAGAAGAGGCAAGG + Intergenic
917605056 1:176619025-176619047 ACTGAGAGTCGAAGGGGGTATGG + Intronic
918261153 1:182797532-182797554 CATGAAAGGCAGAAGAGGTATGG - Intronic
919538631 1:198820487-198820509 ACTGAGAGACAGCAGGGCCAGGG + Intergenic
919907548 1:202088270-202088292 ACAGAGGGGTAGAAGGGGTGGGG + Intergenic
920637250 1:207715802-207715824 ACTGGGAGGCTGAAGTGGGAGGG - Intronic
921671169 1:217925330-217925352 CCTGGGAGGCAGGAGGGCTATGG - Intergenic
922310626 1:224386452-224386474 ACTGTGAGGCAGAGGTGATAGGG + Exonic
924715255 1:246566809-246566831 CCTGAGAGGCGGAGGAGGTAAGG - Intronic
1063201982 10:3792936-3792958 ACTGAGAGAAAGAAAGGGGAAGG + Intergenic
1063439365 10:6059953-6059975 GTTGAGGGGCAGATGGGGTATGG + Intronic
1063444000 10:6097026-6097048 GCTGAAAGGCAAAAGGGGTGGGG - Exonic
1063813279 10:9739615-9739637 ACTGAGATGCAGAAGTGATTAGG - Intergenic
1064911426 10:20405697-20405719 ACGGAGAGGGGGAAGGAGTAGGG + Intergenic
1065578419 10:27147502-27147524 ATTGAGAGGGAGAAGGGTTCTGG + Exonic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1066402220 10:35087596-35087618 ACTGAGATGAAGAAGAGGTTGGG - Intronic
1066442058 10:35448730-35448752 TCAGAGAGGCAGCAGGGGCAGGG + Intronic
1067080540 10:43209957-43209979 ACTGAGAGGCTGTAGGGGAAGGG - Intronic
1068805080 10:61186160-61186182 ACTAAGAGGAGGAAGGGGGAAGG + Intergenic
1068842204 10:61628111-61628133 ACAGAGAGACAGAAGGGAAATGG + Intergenic
1069065984 10:63942310-63942332 ACTGAGAGGGAGAAGGAAAATGG - Intergenic
1069655089 10:70081700-70081722 ACTGGGAGACAGAGGGGGTGGGG + Intronic
1070384995 10:75916389-75916411 AGAGAGAGGCAGCAGGGGTGAGG + Intronic
1070473691 10:76811447-76811469 ACAGAAAGGGAGAAGGGGTTGGG - Intergenic
1071254634 10:83860719-83860741 ACTCAGAAGCTGTAGGGGTAGGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072373874 10:94794289-94794311 CCTGGGAGGCACAAGGGGTGGGG - Intronic
1072971333 10:100020266-100020288 AATAAGAGACAGTAGGGGTAGGG + Intergenic
1073136684 10:101224342-101224364 AATAAAAGGCAGAAGGGGAAGGG + Intergenic
1073259932 10:102182053-102182075 ATTAAGAGGCAGAGGGGGTGGGG - Intergenic
1073307989 10:102518239-102518261 ACTGAGATGCAGAAATGTTAAGG + Intronic
1073923457 10:108485621-108485643 ACAGAGTGGCAGAATGGATAAGG - Intergenic
1074404669 10:113170535-113170557 AGAGAGAGGCAGAAGGTGTCTGG - Intergenic
1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG + Intronic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1076590093 10:131576952-131576974 ACTGACACGCAGAAGGCGCATGG + Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078357976 11:10647038-10647060 GCTGGCAGGCAGAAGGGGTTTGG + Intronic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1078729317 11:13961535-13961557 ACTGAGAGGCAGGGGGCTTATGG + Intergenic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1079329449 11:19521602-19521624 ACAGAGTGGCAGATAGGGTAAGG - Intronic
1079621923 11:22566374-22566396 GCTGGGAGGCAGCAGGGGAAGGG + Intergenic
1079691098 11:23417992-23418014 AATGAGAGGCTGGAGGGGTGGGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080580632 11:33640423-33640445 AATGAGAGGCAGAAGAGGTGTGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1084596947 11:70122627-70122649 ACAGAGAGAGAGAAGGGGGAGGG - Intronic
1084772764 11:71354623-71354645 ATTCAGAGACAGAAGGAGTATGG - Intergenic
1085342985 11:75745453-75745475 ACTGGGAGGCAAATGGGGTTCGG + Intergenic
1085618488 11:78020113-78020135 ACTGAAAGGTAGGAGGGGTCAGG + Intronic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1087100446 11:94358903-94358925 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
1087129988 11:94660457-94660479 ACTGAGAGGCAGATGCTGGATGG - Intergenic
1087797506 11:102470068-102470090 ACTGAGGGGCATAAGGCATAAGG - Intronic
1088004753 11:104926961-104926983 CCTGAGAGCCACAAGGGGCAGGG + Intergenic
1088174462 11:107035548-107035570 AATGAGAGCAAGAAGGGGTCTGG + Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089035851 11:115390350-115390372 AGAGAGAGGGAGAAGGGGAAAGG + Intronic
1089185119 11:116609745-116609767 ACTGAGATCCAGAAAGGTTAAGG + Intergenic
1089498630 11:118920204-118920226 ACTGAGATGCAGCAAGGTTATGG + Intronic
1089568368 11:119385175-119385197 ACTGTGAGGATGAAGGGGAAAGG + Intergenic
1089659007 11:119973792-119973814 TCTGAGAGGCAGAGGGGGCCTGG + Intergenic
1089705161 11:120272443-120272465 AATGGGAGGTAGAAGGAGTAGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090693829 11:129215948-129215970 AGAGAGAGGCAGAGGGGGTCTGG + Intronic
1091059268 11:132446319-132446341 ACAGAGAGGCAGAGGAGGGAGGG + Intronic
1091387235 12:103178-103200 ACTGAGAGCCTGAAAGGGAAGGG - Intronic
1091790925 12:3271752-3271774 AGGGAGAGGCAGGAGGGGCAGGG - Intronic
1092252727 12:6909841-6909863 ATTGAGAGGGAGCAGGGATAGGG - Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092978796 12:13772669-13772691 ACTAAGAGCAAGAAGAGGTAAGG + Intronic
1093223419 12:16450511-16450533 GCTGAGAGGTAGAAAGTGTAAGG + Intronic
1097007549 12:55930071-55930093 ACTGATAGGCAGAGGTGTTAGGG + Intronic
1097722289 12:63035507-63035529 AGAGAGAGGCACAAGTGGTAAGG + Intergenic
1097931567 12:65193168-65193190 ACTGAGAGGCATAAGGCAGAAGG + Intronic
1098151956 12:67555986-67556008 TCTGGGAAGCACAAGGGGTAGGG - Intergenic
1098171945 12:67755963-67755985 AGTGGGAGGGAGAAGGGGAATGG - Intergenic
1099022599 12:77424811-77424833 CCTGGGAAGCACAAGGGGTAAGG - Intergenic
1100750939 12:97697511-97697533 CCTGAGAAGCAGAAGAGCTAAGG - Intergenic
1101364597 12:104060123-104060145 TCATAGAGGCAGAAGTGGTAAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101990911 12:109484292-109484314 ACTGACAGGCAGCAGTGGTAAGG + Intronic
1102217909 12:111174632-111174654 ACTGAGATTCAGAAAGGGCACGG + Intronic
1102751512 12:115298758-115298780 ACTGAGACGCAGAGAGGTTAAGG - Intergenic
1102822571 12:115920829-115920851 ACTGAGACTCAGAAGTGATATGG + Intergenic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103552745 12:121748266-121748288 ACTCAGAGGGAGGAGGGCTATGG - Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1104044171 12:125150051-125150073 ACAGAGAGAAAGAAGGGGCATGG - Intergenic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1105891572 13:24685979-24686001 TCTTAGAGGCAGAAGGGACATGG + Intronic
1106477211 13:30108973-30108995 GCTGAGAGGCAGGCGGGGTCAGG + Intergenic
1106747980 13:32724222-32724244 ACTGAGAGGCTGAGGTGGGATGG - Intronic
1107568570 13:41631938-41631960 ATTGAGAGACAGCATGGGTAGGG + Intronic
1107968920 13:45622642-45622664 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1108107277 13:47024785-47024807 ACAGAGAGGGAGCAGGGATAGGG - Intergenic
1108456504 13:50620465-50620487 ACTGAGAGGTAGACAAGGTAAGG + Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108702141 13:52952823-52952845 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1110470372 13:75853344-75853366 ACTGTGAAGCTGAAGGGGAATGG - Exonic
1110609582 13:77474171-77474193 ACTGAGAGGCATAAGGCAAAAGG + Intergenic
1110979169 13:81873591-81873613 ACTGAGGGGCATAAGGCATAAGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114264034 14:21060742-21060764 ACTGAGAGGCTGCAGGAGAAGGG - Intronic
1114317339 14:21521385-21521407 ACGGATAGGCAAAATGGGTAGGG + Exonic
1114341874 14:21753955-21753977 TCTGGGAAGCAGAAGGGGTCAGG + Intergenic
1114422073 14:22592684-22592706 ACTGAAAGGATGAAGGGATATGG - Intergenic
1115255453 14:31396296-31396318 ACTGAGAGGCTGAGGTGGGAGGG + Intronic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1118685995 14:68291855-68291877 ACAGACAGGGAGAAGGGGTAGGG - Intronic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118932168 14:70252963-70252985 CCTGAGAGACAAAAGGGGGAAGG - Intergenic
1119536996 14:75410589-75410611 GCAGAGTGGCAGAATGGGTAGGG + Intergenic
1119885416 14:78136563-78136585 ACTGAGAAGTACAAGGGGAAGGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121202399 14:92129318-92129340 TTTGAGAGGGAGAAGAGGTAGGG + Intronic
1121522735 14:94597581-94597603 ACTGAGAGGCACCTGGGGTAGGG + Intronic
1122023808 14:98859986-98860008 ACTGAGGGGCAGCAGGGGCCAGG + Intergenic
1122744242 14:103888598-103888620 GCTGAGAGGCAGAGGGGCTGAGG + Intergenic
1122897947 14:104769626-104769648 ACTGTGACACAGAAGGGGAAGGG + Exonic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123817997 15:23999079-23999101 ACTGAGAGCCTCAAGGGGGAGGG + Intergenic
1124210870 15:27764083-27764105 ACTGAGAAACAGAAGGGACAGGG + Intronic
1124840239 15:33234708-33234730 ACTGTGAGGCAGAAGTGGACAGG + Intergenic
1125352192 15:38779515-38779537 ACTGGGAAGTACAAGGGGTAGGG - Intergenic
1126902180 15:53325763-53325785 ACTGAGAGCCAGATGAGGTGAGG + Intergenic
1127042298 15:54990700-54990722 CCTGAGAGCCACAAGGGGCACGG + Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128108933 15:65064047-65064069 ACTGAGAGCCATAAGGTGTCTGG - Intronic
1128215881 15:65933721-65933743 CCTGAAAGGCAGCAGGGGTGAGG + Intronic
1128334248 15:66775896-66775918 ACTGAGAGGCACAGGGGGAGGGG + Intronic
1128760312 15:70212328-70212350 TCTGAGAGGAAGAAGTGGAAAGG - Intergenic
1128889606 15:71318820-71318842 CCTGAGAGGCAGGAGGGCTGGGG + Intronic
1129249764 15:74302486-74302508 CCTGAGAGGCAGGTAGGGTAGGG - Intronic
1129258476 15:74348172-74348194 ACTGAGACTCAGAGGGGTTAAGG - Intronic
1129410845 15:75349426-75349448 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1129712632 15:77828345-77828367 ACTGAGATGAAAAAGGGGCAAGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130672438 15:85924422-85924444 ACTGAGGGGCAGAATGGTTAAGG + Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131150138 15:90042647-90042669 ACTGAGAGACAGCAGGAGAAGGG + Intronic
1131308110 15:91263820-91263842 ACTGAAAGGGAGGAGGGGCACGG - Intronic
1131423317 15:92325701-92325723 ACTGAGAGGCAGAATGGTTATGG - Intergenic
1131612862 15:93983369-93983391 AAGGAGAGGCTGAAGGGATATGG - Intergenic
1131714794 15:95096691-95096713 TCTGCCAGGCAGAAGGGGAATGG - Intergenic
1131771495 15:95742752-95742774 AATGAGAGACAGAAGATGTAAGG - Intergenic
1132346335 15:101111338-101111360 AGTGAGAGGCCGATGGGGTCTGG - Intergenic
1132667469 16:1088810-1088832 ACTAAGAAGCAGCAGGGGTCAGG - Intergenic
1133221113 16:4319570-4319592 ACTGAGAGGCAGATGTGGCCCGG - Intronic
1134107730 16:11495802-11495824 GCTGAGACACAGAAAGGGTAAGG + Intronic
1134207969 16:12253110-12253132 GCTGAGGGGCAGGAGGGTTAGGG - Intronic
1134819920 16:17238714-17238736 ACTAAGAGCCAGAAGGCGGAAGG - Intronic
1135346888 16:21696369-21696391 ATTTGGATGCAGAAGGGGTAAGG + Intronic
1135526003 16:23214170-23214192 ACTGAGATGCAGATTGGTTAAGG - Intronic
1135825908 16:25728740-25728762 ACTGAGAAACAGAAGATGTAAGG - Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136296499 16:29307041-29307063 AGTGAGAGGCAGACTGGGAATGG - Intergenic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137753244 16:50881995-50882017 AGTGAGGGGCAGAAGAGGTCAGG - Intergenic
1138520390 16:57567744-57567766 ACTGAGGCGAAGAAGGGGCAGGG - Intronic
1138613976 16:58149819-58149841 ACCGAGAGGCGGAAGTGGTCTGG + Intergenic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1139179824 16:64733606-64733628 ACAGAGAGGCAGAAGTGGTTTGG + Intergenic
1139524358 16:67504820-67504842 ACTGAGAGAGAGAAGGGGGCTGG - Intergenic
1139532399 16:67548842-67548864 CCTGTGAGGCAGAGGGGGTCAGG - Intergenic
1139603412 16:68000801-68000823 ACAGAGAGGCTGGCGGGGTAGGG - Intronic
1139939670 16:70596163-70596185 CCTCAGAGGCAGGAGGGGTGAGG + Intronic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140170392 16:72598647-72598669 ACTGAGTGGGAGGAGGGATAGGG + Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140763802 16:78137085-78137107 AGTGAGTGGCAGAGGGGGTCAGG + Intronic
1140802163 16:78498484-78498506 ACTGAGAAGCACAAGGTGTGAGG + Intronic
1140977446 16:80073671-80073693 ACTGCGAGGCAGAAGGAGTGAGG + Intergenic
1141336265 16:83158291-83158313 TCAGAGAGGCAGCAGGGGTGGGG - Intronic
1141367570 16:83457455-83457477 ATTGAAAAGCAGAGGGGGTAAGG - Intronic
1141703881 16:85654389-85654411 GGGGAGAGGCCGAAGGGGTAGGG - Exonic
1141957560 16:87383158-87383180 CAAGAGAGGCAGACGGGGTAGGG - Intronic
1142058080 16:88013160-88013182 AGTGAGAGGCAGACTGGGAATGG - Intronic
1142109500 16:88323683-88323705 ACTGAGTGGCAGAAGTGGGCAGG + Intergenic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142769847 17:2088743-2088765 ACTGAGAGGCAGAATGTCCAGGG + Intronic
1142781053 17:2181666-2181688 ACAGAGAGGCAGAGGGGGTTGGG - Intronic
1143217161 17:5233659-5233681 ACTGAGAGGCAGGCGGGGCATGG - Intronic
1143892520 17:10113619-10113641 AGTGAGAGGCACAAGTTGTAGGG - Intronic
1143988410 17:10935514-10935536 ACTGGGAGGCTGGAGGGGTCAGG + Intergenic
1144494568 17:15738149-15738171 ACTGAGAGGCAGACGGTGCCAGG - Intronic
1144648345 17:16990599-16990621 ACAGAGAGGCAGTAGAGGCAGGG - Intergenic
1144789262 17:17848320-17848342 ACGGAGAGGCAGATGGAGTGGGG + Intronic
1144837055 17:18162003-18162025 ATTCAGAGGCAGGAAGGGTAAGG - Intronic
1145017890 17:19411014-19411036 ACAGAGAGGGAGAAGGCGTGCGG - Intergenic
1145993800 17:29094284-29094306 ACAGAGAGGCAGCTGGGGTGGGG + Intronic
1146257584 17:31400539-31400561 TCGGAGAGGCAGAAGGGGCCGGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147316888 17:39625315-39625337 CCTGAAAGGAAGAAGGGGTATGG - Intergenic
1147476163 17:40713470-40713492 AATGGGAGGGAGAAGGGGCAGGG - Intergenic
1148154008 17:45412328-45412350 TCTGAGAGGCACAAGGGGGAGGG + Intronic
1148444097 17:47727275-47727297 GCTGAGAGGCAGGAAGGGTGGGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148874907 17:50681299-50681321 ACTGAGAGGCAGGAAGGTTGAGG - Intronic
1149002968 17:51775896-51775918 ACAGAGAAACAGAAGGGGAATGG + Intronic
1151332822 17:73421073-73421095 ACAGAGAGGCTGAAAGTGTAGGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151833602 17:76569594-76569616 ACTGGGAGGGAGACTGGGTAGGG + Intronic
1152464637 17:80458853-80458875 ACTGGGAGCCAGCAGGGGAACGG - Intergenic
1152580168 17:81162286-81162308 CCTGAGAGGAAGTAGGGGGATGG + Intronic
1152820294 17:82434328-82434350 AGTGAGTGGCAGGAGGGGCAAGG - Intronic
1154077490 18:11218231-11218253 AGTGAAAGGCAGGAGGGGTGGGG + Intergenic
1154496179 18:14963071-14963093 GCTGAGAGGCAGGAGGGTTGAGG + Intergenic
1155145417 18:23079207-23079229 ACAGAGAGGGAGAAGAGGGATGG + Intergenic
1155546775 18:26923985-26924007 AGGGAGAGGCAGGAGGGGTTGGG + Intronic
1156530084 18:37806487-37806509 CCTGAGAGGCACAGGGGGCAGGG - Intergenic
1156800678 18:41109555-41109577 ACTTAGAGGCAGCTGAGGTAGGG - Intergenic
1157123457 18:44933879-44933901 CCTGGGAGGCATAAGGGGTTGGG - Intronic
1157472940 18:48003627-48003649 ACTGAGAGTCAGAAAAGGCATGG - Intergenic
1159664328 18:71139688-71139710 ACAGATAGGAAGATGGGGTATGG - Intergenic
1160175961 18:76594409-76594431 ACTGAGGCACAGAAGGGCTACGG + Intergenic
1160465657 18:79073672-79073694 ACGGAGAGGGAGAAGGGAGAGGG + Intronic
1161063047 19:2224698-2224720 ACTGGGAGGCAGAAGGCTTGAGG - Intronic
1161751717 19:6102577-6102599 AAGGAGAGGCAGAAGAGGCAGGG - Intronic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162216718 19:9140607-9140629 ACTGAGGGGGAGAAGGGTTAAGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1163648611 19:18504191-18504213 ACAGAGAGGCTGGAGGGGTGAGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164090955 19:21951854-21951876 CCTGGGAGGCACAAGGGGTTGGG + Intronic
1164487089 19:28667845-28667867 ACAGGGAGGCATAAGGGATAAGG + Intergenic
1164684529 19:30158134-30158156 AATGGGGGGCAGCAGGGGTAAGG + Intergenic
1165765486 19:38348035-38348057 ATTCAGAGCCAGAAGGGGTCAGG - Intronic
1166134757 19:40769325-40769347 ACTGAGAGGCCGAGGTGGGAGGG + Intergenic
1166317442 19:41997130-41997152 TCTGAGACGCAGAAGGGGACGGG + Intronic
1166983000 19:46642707-46642729 GGTGAGAGGGAGAAGAGGTAAGG - Intergenic
1167250765 19:48397305-48397327 AATGAGAGGGAAAAGGGGTCAGG - Intronic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167588879 19:50391681-50391703 ACTGAGAGGGGGGAGGGGGAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
924982297 2:235328-235350 AATGAGAGGCAGCATGGGTCAGG + Intronic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925274765 2:2640992-2641014 AAGCAGAGGCAGAAGGGGTGTGG + Intergenic
925615394 2:5740487-5740509 AGCCAGAGGCAGAATGGGTAAGG - Intergenic
926113619 2:10197468-10197490 ACTGGGAAGCAGAAGGGCTGGGG + Intronic
926348213 2:11968896-11968918 ACTGAAAGTCAGAACGGTTAAGG - Intergenic
926873118 2:17445647-17445669 CCTGAGAGCCACAAGGGGCAGGG + Intergenic
927000474 2:18789546-18789568 ACTGAGAGGCAGATGGTCTTTGG - Intergenic
927090190 2:19704779-19704801 ACTGCAAGGCAGGAGGGGAAAGG - Intergenic
927511020 2:23643630-23643652 ACTGGAAGGCAGAAGGGGACAGG + Intronic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
932494320 2:72138963-72138985 GGTGAGAGGCAGGAGGGGTGAGG - Intronic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
933080395 2:77977658-77977680 ACTTAGAGGCAGCAGGGGAAGGG - Intergenic
933792420 2:85893726-85893748 TCTGTGAGGCAGGAGGGGTGAGG + Intergenic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934810595 2:97273346-97273368 ACTTTGAGGCAGAAGAGGAAGGG - Intergenic
934827097 2:97434593-97434615 ACTTTGAGGCAGAAGAGGAAGGG + Intergenic
934884225 2:98010452-98010474 AGTGAGAAGCAGAAGGTGTGTGG - Intergenic
935127873 2:100239974-100239996 AGTGAGAGTCAGAAGAGGCAAGG + Intergenic
935421076 2:102869479-102869501 CCAGAGAGGAAGAAGGGGAAAGG + Intergenic
935961415 2:108429325-108429347 CCTGAGAAGCACAAGGGGTCAGG + Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
937344861 2:121119264-121119286 GCTGAAAGGCATAAGGGGAAGGG + Intergenic
937630147 2:124092183-124092205 ACTAAGAGACAGAAAGGTTAAGG + Intronic
937658565 2:124404591-124404613 ACTGAGTGGCAGAAGGGCAGGGG + Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938235841 2:129706490-129706512 ACTGAGCAACAGATGGGGTAGGG - Intergenic
938314730 2:130317750-130317772 ACTGAGAGGGTGCAGGGGGAGGG - Intergenic
938559952 2:132463291-132463313 ACTGAGAGAAAGCAGGGCTAGGG + Intronic
939176689 2:138757298-138757320 TCTGAGATGTAGAAGGCGTAAGG + Intronic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
941545513 2:166845666-166845688 AATCTGAGGGAGAAGGGGTATGG + Intergenic
942082081 2:172409854-172409876 ACTGAGACCCATAAAGGGTAAGG - Intergenic
942672595 2:178392366-178392388 TGTGAGAGGCAGAAGGTTTATGG - Intronic
943628430 2:190223966-190223988 CCTGAGAAGCAAAAGGGGTCGGG + Intronic
944106931 2:196089366-196089388 CCTGAGAAGCACAAGGGGTTAGG + Intergenic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
945671352 2:212806131-212806153 TCTTAGTGGCAGAAGGGGCAAGG - Intergenic
946078963 2:217099927-217099949 ACCCAGAGCCAGAAGGGGTGTGG + Intergenic
946178109 2:217934287-217934309 ACAGAGAGGCAGAGGGGATGAGG + Intronic
946459745 2:219858212-219858234 ACAGAGAGGGAGGAGGGGTTTGG - Intergenic
946720304 2:222598713-222598735 ACTGGGAGGCAGAAGCTGTGGGG + Intronic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
947205950 2:227661237-227661259 ACTGCGAGGCAGTGGGGGTGGGG + Intergenic
947698935 2:232216536-232216558 AATCAGAGGCAGAATGGCTAGGG - Intronic
947900097 2:233714051-233714073 ACTGAGAGGAAGGAGAGGCAGGG + Intronic
947900803 2:233719859-233719881 ACTGAGAGGAAGAAGAGGCACGG + Intronic
1168789007 20:563545-563567 AGTGAGAGGGAGAGGCGGTAGGG + Intergenic
1169149708 20:3279780-3279802 GCTGGGAGGCAGCAGGGCTAAGG + Intronic
1169631279 20:7635219-7635241 CCTGGGAGGCAGAAGTGGCAGGG - Intergenic
1170008734 20:11697451-11697473 ACTGAGAGGCAGAAGTGCCTGGG - Intergenic
1172165064 20:32893886-32893908 AATAAGAGGCAGAAAGGGTAAGG + Intronic
1173018200 20:39245722-39245744 TCCCAGAGGCAGAAGGAGTAGGG + Intergenic
1173301436 20:41807189-41807211 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173385267 20:42581807-42581829 ACTCAGAGGTTGAAGGGGGAGGG + Intronic
1174532545 20:51225504-51225526 TCTGAAAGGCAGATGGGGTGGGG - Intergenic
1174840248 20:53894567-53894589 ACTGAGAAGCAAAAAGGTTAAGG - Intergenic
1175451470 20:59072408-59072430 ACTGGGAGCCAGAAGAGGCAAGG + Intergenic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1177668112 21:24188299-24188321 GTTGAGAGACAGAAGGGGTGGGG - Intergenic
1177854562 21:26386598-26386620 ACTGAGAAGTAGTAGGGGAAAGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178830401 21:36051572-36051594 ACAGAGAGGCAGAATAGGTGGGG + Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1179899818 21:44384442-44384464 ACTGGAAGGCAGAAGGGTAAGGG + Intronic
1179979270 21:44887973-44887995 CCTGAGAGGCAGAGGGGCTGGGG - Intronic
1180709837 22:17832153-17832175 ACTGAGAAGGGGAAGGGGAAGGG + Intronic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181977188 22:26738401-26738423 AGGGAGAGGGAGAAGGGGAAGGG - Intergenic
1182160559 22:28116913-28116935 ACTCACAGGCAGAAGAGGCAGGG - Intronic
1182170285 22:28221713-28221735 AGTTAGAGGCAGAAGAGATAGGG - Intronic
1182558501 22:31141617-31141639 ACTGTGTGGCAGAGGGGGAAGGG + Intergenic
1182964994 22:34512642-34512664 ACTGAGAGCCAGGAGTGATAAGG + Intergenic
1183268985 22:36849106-36849128 ACGGAAGGGCAGAAGGTGTAGGG - Intergenic
1183273732 22:36878182-36878204 AGTGGGAGGGAGAAAGGGTATGG - Intergenic
1184341465 22:43888320-43888342 CCTGAGAGGTAGAAGGGACAAGG + Intronic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
949264164 3:2137833-2137855 ACTCAGATGCAGTAGGGGTGGGG - Intronic
949396289 3:3617628-3617650 ACCGAGAGGCATAAGGGAGAGGG - Intergenic
949441490 3:4085893-4085915 TTTGAGAGGCAGAAGAGGAAAGG - Intronic
951777328 3:26324338-26324360 CCTGAGAAGCATAAGGGGTCAGG - Intergenic
952181886 3:30925499-30925521 GCTGAAAGGCAAAAGGGGAAGGG - Intergenic
952763416 3:36935086-36935108 GCTGGGAGGCAGATGGGGTTGGG - Intronic
952929678 3:38349342-38349364 ACTAAGGGCCATAAGGGGTAGGG + Intronic
953254628 3:41277998-41278020 CCTGGGAGGCACAAGGGGTCGGG + Intronic
953643868 3:44735423-44735445 ACTGAGGCTCAGAAGGGATAAGG - Exonic
953852907 3:46479425-46479447 ACTGAGAGGCAGAACAAGTGGGG + Intronic
954439790 3:50515625-50515647 ACTGAGAGGCAGAGGAGAAATGG - Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
959278148 3:104304192-104304214 CCTGGGAGGCAGAAGGGGTTGGG + Intergenic
960128951 3:114032648-114032670 AATGAGTGAGAGAAGGGGTAGGG - Intronic
961166885 3:124769715-124769737 TCTGAGAGGGAGAAGGGGGCTGG - Intronic
961516426 3:127440237-127440259 ACTCAGAGGCTGAAGGGGGCTGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962268080 3:133957655-133957677 CCTGAGAGGAAGTAGGTGTAAGG - Intronic
962299813 3:134229328-134229350 AAGGAGAGACAGAAGGGGTTGGG - Intronic
962754199 3:138455907-138455929 ACTTCGAGGCAGGAGGCGTAGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
964571430 3:158110699-158110721 AGTGTGAGCCAGAAAGGGTAGGG - Intronic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
965911702 3:173785943-173785965 AGTGAGAGGTAGAAGAGGAAAGG + Intronic
966267408 3:178063018-178063040 CCTGAGAGCCACAAGGGGCAGGG - Intergenic
967038133 3:185663354-185663376 ACTGAGAGGCAGAGGGAGATGGG + Intronic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967263752 3:187671779-187671801 GTTGAGAGGCAGAAGGGTTTGGG + Intergenic
967297567 3:187980043-187980065 ACTGAGAGGTAGCTGGGGAAGGG + Intergenic
967311437 3:188110095-188110117 ATTGAGTGGCAGTAGGGGAAGGG + Intergenic
967494484 3:190127644-190127666 AGTTAGAGCCAGAAGGAGTAAGG - Intergenic
967703527 3:192622200-192622222 ACTGAGAGACAGGAAGGCTATGG + Intronic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971621356 4:28857442-28857464 CCTGAGAAGCACAAGGGGTCGGG - Intergenic
972898541 4:43654548-43654570 CCTGAGAAGCACAAGGGGTCAGG + Intergenic
972977225 4:44650853-44650875 ACTGAGAGAAGGAAGAGGTATGG + Intronic
976024974 4:80675977-80675999 CCTGAGAAGCACAAGGGGTTGGG - Intronic
976676142 4:87705539-87705561 ACTAAGAGGCAGTGGGGGTCTGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977509104 4:97938712-97938734 CCTGAGAGCCACATGGGGTAAGG - Intronic
978068169 4:104432125-104432147 ACTTAGAGGCAAAGGGGGAAGGG - Intergenic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978482619 4:109211503-109211525 AGTGATAGGGAGAAGAGGTATGG + Intronic
978669035 4:111224012-111224034 ACAGAGAGGCAGAAGCAGTGGGG + Intergenic
979342518 4:119543405-119543427 ACTCAGAGACAGAAGTGATAAGG - Intronic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
981856299 4:149296904-149296926 CCTGGGAGGCAGAGGTGGTAGGG + Intergenic
983167765 4:164497982-164498004 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
984092015 4:175386976-175386998 ACTGAGAGCCACACAGGGTAGGG + Intergenic
985175844 4:187199957-187199979 ACAGAAACGCAGGAGGGGTAAGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
986231316 5:5867058-5867080 ACTGAGAGGTACAGGGGGAAAGG - Intergenic
987457215 5:18162694-18162716 ACTGAGAGCCACATGGGGCAGGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
989266017 5:39474975-39474997 ACTGGGATACAGAAGGTGTAGGG + Intergenic
989363868 5:40634351-40634373 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
989779165 5:45243770-45243792 CCTGAGAAGCACAAGGGGTCAGG - Intergenic
991210122 5:64094662-64094684 ACTAAGAGGCACAAGTTGTAGGG + Intergenic
991503694 5:67302967-67302989 ACAGAGAGGGAGAAGGGGTAGGG + Intergenic
991569220 5:68036798-68036820 AAAGAGAGGGAGAAGGGGTGGGG + Intergenic
991937703 5:71818139-71818161 TGTGGGAGGCAGAAGAGGTAGGG + Intergenic
992374506 5:76175043-76175065 TGAGAGAGGCAGAAGGGGAAGGG + Intronic
993052318 5:82939896-82939918 ACAGAGAGAGAGAAGGGGGAGGG - Intergenic
993392035 5:87330688-87330710 ACTGAGAGCAAGAAGGGTGAAGG + Intronic
993603130 5:89953450-89953472 ACTTGGACGCAGAATGGGTAAGG + Intergenic
994727592 5:103454571-103454593 AATGAGGGGCAGAATGGGCAAGG - Intergenic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
995695340 5:114872921-114872943 ACTGAGAGGGAGAAAGGCTATGG - Intergenic
997255504 5:132425028-132425050 TGTGAGAGGCAGAGGGGGTTAGG + Intronic
997434136 5:133862030-133862052 ACTGAGAAGCAGGAGGGGCCAGG + Intergenic
997719453 5:136065952-136065974 AAGGAGAGGAAGAAGGGGAATGG + Intergenic
997880596 5:137586071-137586093 ACTGAGACACAGAGAGGGTAAGG + Intronic
1000342045 5:160285417-160285439 GCTGAAAGACAGAAGGGGTGGGG + Intronic
1000574782 5:162964626-162964648 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1002297293 5:178238808-178238830 ACTGAGAGGGAGTGGGGGGAGGG - Intronic
1002514502 5:179747310-179747332 AGTGAGAGTCAGAAGCTGTATGG + Intronic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004622909 6:17346999-17347021 TCTGAGAGGCACAAGAGGAAGGG - Intergenic
1005000005 6:21230889-21230911 ACTGAGATGCAGCAGAGGTGTGG - Exonic
1005481751 6:26261566-26261588 ATTGAGAGACAGGAGGGGTGGGG - Intergenic
1005940165 6:30554974-30554996 ACTGTGAGGAAGGAGGGGTCTGG - Intronic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1006718698 6:36136368-36136390 ACTGAGGCCCAGAAGGGGAAGGG + Intronic
1006739073 6:36294399-36294421 GGTGAGAGGCAGGAGGGGTCTGG + Exonic
1006905095 6:37528000-37528022 ACTGAGAGCCAGCTGGAGTATGG - Intergenic
1007307201 6:40916342-40916364 ACTGAGAGGAAGAAGAGCTAAGG - Intergenic
1007861670 6:44916373-44916395 GCTTAGAGGCAGTAAGGGTATGG - Intronic
1009316805 6:62229751-62229773 CCTGAGAGCCACAAGGGGCAGGG - Intronic
1009929990 6:70165716-70165738 AGTGAGAGTCAGAATGGGTATGG + Intronic
1010283038 6:74041843-74041865 ACTGAGAGCCATACGGGGTAGGG - Intergenic
1010615288 6:78005506-78005528 CCTGAGAAGCACAAGGGGTCAGG + Intergenic
1013248882 6:108314693-108314715 TCTAAGAAGCAGAAGGGGTTTGG - Intronic
1014157848 6:118132845-118132867 ACTGAAATGCAGAAGGGGCGGGG + Intronic
1014474204 6:121852798-121852820 ACTTCGAGACAGAAGAGGTATGG + Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1014688230 6:124530469-124530491 AATGGGAGGCAGGAGAGGTAGGG + Intronic
1015867112 6:137738821-137738843 ACTGAGATCCAGAAGGGTTAGGG + Intergenic
1015976592 6:138796936-138796958 AGTGGGAGGAAGAAGGGTTAAGG + Intronic
1015994574 6:138984998-138985020 TTTGAGTGGCAGAAAGGGTAAGG - Intronic
1016121075 6:140341540-140341562 ACCAAGAGGCTGAAAGGGTAGGG + Intergenic
1016550040 6:145269498-145269520 ACAAAGAGGCAGAAGAGATAAGG + Intergenic
1016903844 6:149129672-149129694 ACTGAGAAGAGGAAGAGGTAAGG + Intergenic
1018296025 6:162344876-162344898 CGTGATAGGCAGAAGAGGTAAGG + Intronic
1019178610 6:170173796-170173818 AGGGAGAGGAAGAAGGGGCAGGG + Intergenic
1019724730 7:2595273-2595295 ACTGAGAGGCAGGAGGGGCTTGG + Intronic
1021891805 7:25193827-25193849 ACCTGGAGGCAGAAGGGGTCAGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022320885 7:29286533-29286555 AATGAGAGGAAGAAAGGGTAAGG - Intronic
1023247392 7:38219726-38219748 ATTGAGAAACAGAGGGGGTAGGG - Intronic
1023665457 7:42518303-42518325 AATGAGAGGAAGAAGGTCTAAGG + Intergenic
1023905872 7:44521304-44521326 ACCTACAGGCAGAAGGGGAAAGG + Intronic
1024119440 7:46222094-46222116 GCTGAGAGGAAGTAGGGGCAGGG + Intergenic
1024461655 7:49665945-49665967 ACTGGGAAGCACAAGGGGTCAGG + Intergenic
1024892323 7:54218323-54218345 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
1026737977 7:72960924-72960946 ACTGAGAGGCACATGGGGCTGGG - Intronic
1027105757 7:75404144-75404166 ACTGAGAGGCACATGGGGCTGGG + Intronic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027529035 7:79307101-79307123 ACTGAGCAGCAGGAGTGGTAGGG + Intronic
1027582793 7:80020006-80020028 CCTGGGAAGCACAAGGGGTAGGG + Intergenic
1028114457 7:86981865-86981887 ACTGGGAAGCACAAGGGGTCAGG + Intronic
1028331303 7:89596453-89596475 AGTGAGAGGGAGAAGTGGTAAGG - Intergenic
1028380953 7:90197877-90197899 AGTGAGAGAGAGAAGGAGTAAGG - Intronic
1029353260 7:100030631-100030653 ACTGAGTGGCTGAAGAGGTGAGG - Intronic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1029812562 7:103064219-103064241 ACAGGGAGGCAGAAGGTATAGGG - Intronic
1030105363 7:105982549-105982571 ACTGAGGGGGAGAAGGGGAAAGG - Intronic
1030221054 7:107099446-107099468 ACTGGGAAGCACAAGGGGTCAGG - Intronic
1030515553 7:110533792-110533814 ACTGAGAGGCATAAGGCAGAAGG - Intergenic
1031119280 7:117703079-117703101 TCTGCAAGGCAGAAGGGGTTCGG + Intronic
1031176566 7:118359703-118359725 ACTGAGAGACAGAAGGGCAGGGG + Intergenic
1031517525 7:122719244-122719266 AGTGAGGGGAAGAAGGGGTGGGG + Intronic
1033611264 7:142965079-142965101 ACTGAGAGGCTCAATGGTTAAGG - Intergenic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1034993872 7:155566037-155566059 ACTGAGAGACAGCAGGGAGACGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1036512937 8:9417433-9417455 ACTGAGCTGCAGAAGGCCTAGGG - Intergenic
1038021390 8:23554422-23554444 ACTGCGAGACAGAAAGGGAAGGG - Intronic
1038134043 8:24766675-24766697 ATTCAGAGGCAGAAGGGGAGGGG + Intergenic
1039302110 8:36221082-36221104 ATTGAGAGACAGGAGGGGTAGGG - Intergenic
1039320109 8:36420171-36420193 ACTGAGAGGTAAAAGGATTAAGG + Intergenic
1039868988 8:41529447-41529469 ACTGAGAGGGAGGAGGGGAGGGG + Intronic
1040460984 8:47647954-47647976 TCAGAGAGGTAGAAAGGGTAGGG + Intronic
1041336922 8:56795758-56795780 ACAGAGAGAAAGAAGGGCTATGG - Intergenic
1043938900 8:86174323-86174345 CCTGGGAAGCAGAAGGGGTGGGG - Intergenic
1045476814 8:102560134-102560156 ACTGAGGTACAGAAGGGTTAAGG + Intronic
1045634027 8:104161962-104161984 ACTGGAAGGCAGAAGGGATAAGG - Intronic
1047230345 8:122992752-122992774 ACTAAGAGGCAAAATTGGTAGGG - Intergenic
1047612136 8:126531523-126531545 GATGAGAGGCAGGAGGGATAAGG + Intergenic
1047866951 8:129035194-129035216 CCTGCGAGGCAGCAGGGGTGGGG + Intergenic
1047928119 8:129701013-129701035 GCAAAGAGGGAGAAGGGGTAGGG - Intergenic
1048029265 8:130615699-130615721 GCTGAGAGGGAAAAGGGGGAGGG - Intergenic
1048123507 8:131607786-131607808 ACAGGGAGCCAGAAGGGGAATGG + Intergenic
1048186067 8:132241869-132241891 ACTGAGTGGTAGAAGGGTAATGG + Intronic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1048779838 8:137988689-137988711 ACTGTGTGGGAGAAGGGTTATGG + Intergenic
1050233586 9:3555151-3555173 AGAGAGAGGCATATGGGGTAGGG + Intergenic
1050320672 9:4449025-4449047 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
1050404408 9:5292954-5292976 ACTGGGAAGCACAAGGGGTGAGG + Intergenic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1052369149 9:27645063-27645085 CCTGAGAGGCACATGGGGCAGGG + Intergenic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1052693346 9:31844889-31844911 ACTGTCAGACAGAAGGGGTGGGG - Intergenic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1053198927 9:36139628-36139650 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1053577134 9:39364348-39364370 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1053841638 9:42192273-42192295 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054098705 9:60923038-60923060 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054120105 9:61198667-61198689 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054472406 9:65548953-65548975 AGTGATAGGAAGAAGGGGCAGGG + Intergenic
1054587651 9:66983895-66983917 ACTGAGCTGCAGAAGGGCTAAGG + Intergenic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1055047798 9:71948386-71948408 ACTGAAAGGCAAAAGTGTTAAGG + Intronic
1055052825 9:71996854-71996876 CCTGAGAGGCAGAGGTTGTATGG + Intergenic
1055415748 9:76081068-76081090 AATGATAGGCAAAAGGGGTTGGG + Intronic
1056794402 9:89647674-89647696 ACGGAGTGGCTGCAGGGGTAGGG + Intergenic
1057218100 9:93240594-93240616 AATGAGAGGCAGAAGAGACAGGG + Intronic
1057277453 9:93683628-93683650 ACTGAGAGCCAGCAGGGCCAGGG + Intergenic
1057810689 9:98254867-98254889 ACTGAGAGGTAGAAAGACTATGG + Intronic
1057967423 9:99517761-99517783 ACTGCGAGCCAGATGGGGAAAGG + Intergenic
1058610107 9:106766732-106766754 TCTGAGAAGTAGAATGGGTATGG + Intergenic
1059499310 9:114737507-114737529 AGGGAGAGGCAGAAGGGGAGGGG - Intergenic
1059518338 9:114916400-114916422 ACTGAGATCCAGAATGGCTAAGG + Intronic
1060826011 9:126688516-126688538 ACAGAGGGGCAGTAGGGGTTGGG + Intronic
1060864717 9:126986546-126986568 ACTGACAGACAGATGTGGTAAGG - Intronic
1061003651 9:127916511-127916533 ACTCAGAGCCGGGAGGGGTAAGG + Intronic
1062527072 9:136982282-136982304 ACAGGGAGCCAGAAGGGATATGG - Intronic
1203563696 Un_KI270744v1:76690-76712 ACTGAGAGGGTGCAGGGGGATGG - Intergenic
1185626663 X:1487433-1487455 ACTGAGGGGCAGAGGGCATAAGG + Intronic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1187029369 X:15469925-15469947 AGTGAGTGGCAGAAGGAGTATGG + Intronic
1187509941 X:19908636-19908658 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1188972690 X:36636918-36636940 ACTGGATGACAGAAGGGGTAGGG - Intergenic
1189773808 X:44452121-44452143 ACTGAGATGCAGGAAGGGTGAGG + Intergenic
1189953494 X:46255949-46255971 AATGAGAGGGAGATGGGGAAGGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1191021104 X:55860955-55860977 GCTTAAAGGCAGAAGGGCTATGG - Intergenic
1191899758 X:66028701-66028723 CCTCTGAGGTAGAAGGGGTAAGG - Intronic
1192049627 X:67712212-67712234 ATTGAGACCCAGAAGGGGAAGGG - Intronic
1192215167 X:69153113-69153135 AGTGTGAGGCAGAGGTGGTAAGG - Intergenic
1192823550 X:74669766-74669788 ACTGAGTGGGAGAAGGGGTGAGG - Intergenic
1192936425 X:75863177-75863199 ACTGGGAAGCACAAGGGGTTGGG - Intergenic
1192949167 X:75998065-75998087 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193511046 X:82400171-82400193 ACTGGAAGCCAGAAGGGGCACGG + Intergenic
1193719606 X:84971901-84971923 ACTGAGAGCCACATGGGGAAGGG - Intergenic
1194111517 X:89839798-89839820 ACTGAGGGGCATAAGGCATAAGG - Intergenic
1194161921 X:90464674-90464696 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1195916009 X:109936020-109936042 ACTGAGACTCAGAAAGGTTAAGG - Intergenic
1196371471 X:114984200-114984222 AGAGAGAGGCAAAAGGGGAATGG + Intergenic
1197125972 X:122946681-122946703 TCTAAGAGGCAGCAGGGGAAAGG - Intergenic
1197432436 X:126383345-126383367 CCTGAGAAGCACAAGGGGTCAGG + Intergenic
1197615088 X:128681866-128681888 ACTGAGGGGTAGAAGTGGCAAGG + Intergenic
1198039365 X:132834784-132834806 ACTGAAAGGCAAAAAGGGTTTGG + Intronic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1199807273 X:151312751-151312773 ACTGAGGCCCAGAAAGGGTAAGG - Intergenic
1201072956 Y:10166005-10166027 CCTGGGATGCAGAAGGGGTCAGG - Intergenic
1201667332 Y:16473340-16473362 ACTTAAAGTCAGAAGGGGAAAGG - Intergenic
1201910024 Y:19124528-19124550 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1201916838 Y:19191036-19191058 ACTGGGAAGCAAAAGGGGTCAGG - Intergenic
1202092453 Y:21208435-21208457 CCTGAGAGGCACATGGGGTATGG + Intergenic