ID: 1162251281

View in Genome Browser
Species Human (GRCh38)
Location 19:9445760-9445782
Sequence ATCTGGACAATTACCCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162251278_1162251281 6 Left 1162251278 19:9445731-9445753 CCACTGCACTCAGCTGATTTTTT No data
Right 1162251281 19:9445760-9445782 ATCTGGACAATTACCCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162251281 Original CRISPR ATCTGGACAATTACCCAGTT GGG Intergenic
No off target data available for this crispr